Description :
From Genome Similarity Track
Location :
Scaffold_3287:837- 1996
Transcript NameFunction/comments
Phyta_totarag15196hypothetical protein PHYSODRAFT_262200

Sequence
1159 bases(100 bases per row)
TGGAGCAGGCTTCACGCGCTGGCNCGTCGTGCGCATACACGgccttcacgtcgtcgatcagaGACGACAACGGAGTACTTGAACGAGCGACGCCAATGGC
ATTGGCGTCGGCTTTCTTGACAATGTAGTCAGGTCGACGCGATAacgcgtcggccaccacATTCAGTCTTCCGGGTTTGTACTCGACCCGGAAGTTGTAT
TCTGCAAAGAATGACAACCATCGTGCAATTATCTGGGAGATGTGCTGCGACTTAAGCGCCGTACGCAGTGGTACATGATCGGTATAGACCACGAATGGTC
TATTCCCAAGGGGGCTTCCTCGGGCTTCGGAAGACAAGACACTGTGAGATAGTGCATTATGCGGACGACGCGAGCGTGTTCAATGCACATTAGCTCTTCG
CTCAGACGACGGCGGATATCTGTGAAAGTCTCTGACGTCCGGCGCCGTCTCTTGGTcatcacacacacacacagcaaacAACACCTTGCCGTTCTGCATA
TTATTTTCCCCTCGTATGTTTGTACCGTAGCGCAGGAAGTTCGAAGTGTCATGGGAAAAGAGGGAGTCGAGGTTGCTGTGAAGGGTGAAGATGCGCTTTC
TCACCTCCTCGAATCATTAGATATTTTGTTAAATTTGTCCGCAGTAAGAGTCTCCATACTTTCGAGCCATACCGACTTTAAATGTTTTCTTTCTCGCGGG
CACTTAGACTCGACCACGGTTTTGGACGTCGTTTTTCGTTGCCCGTCATTTATCCGGGATAAAAGCTGACCAAGGAAGGATAAAAGGGGGTATAAAACCG
ATAGCGATTAAACCGCTTTATGTGGGTTTTGGAAGGCATCCAATGGGTTGTTCCTGAAAACACACATTTTGCTcgtacagacaatcctctccgtagtgat
agcctcggGAAGCAACcttttattactatctggCTAGCCAGAGCTGTACCATTACGACGGTACAATCTGACGTCTTGGCTACAGGGCTGCATTGGTGATT
GCCACTTCGGATCAGGTGAGCTCGCGCTGCACTGGTGGCTGCTAGTTTCGCTCGTGGCGCAAACCAGCGACTCCTACAGCAACAGAACAAGAATCATCCC
GAAATTTCGCTTCGTCCTCGCACGATgctccccccccccccacacacaaAAAAAACATT