Description :
From Genome Similarity Track
Location :
Scaffold_56:8369- 10490
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_56-abinit-gene-0.80COP9 signalosome complex subunit
Pytul_var.sporangiiferummaker-pug3_contig_56-snap-gene-0.25Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_56-fgenesh-gene-0.15Probable splicing factor 3B subunit 5

Sequence
2121 bases(100 bases per row)
GCTGAATAATAAAGTGATTGCCACGTGCAACAATGTTCCTGTTGCGCGTGAAGAACTTGCATTTTGCCTGGTTAAATTTAGCTTGATTGATGACTGATGT
TACAGATGTATTGGCACTAGGTCACTCGAGCCAATATTCTTTTTATATGGGGTGGAGCAAGCCATCTCTTTCTACAAGTCTGCCGAACCTGCTTGTGACA
CAGCAGGATGAGTGAGAAAGCGGCGAGCGCGGTGCCCGATCTCGACAAAGCGATCCAGCTCCTCAAGGCCAAGCAGAATGCGTACTACATCCAGTCCGTC
AAGGACGCGATGCAGGCTGAGCAGCTCCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNACAAGCTGACGAAAGCGGTCACGCATGTCGAGAGTTCTCGCT
TGGAGAAAAAGTTCGCAAAGGAGCGGAAGCGCGACCGCGAGCGGCTCCAGCAGATCCAGGAAGATCACATGGCGCTCTTGAACGCCAAGATTGCGGAGTG
GAAGGTGCATGGCGTGAAGCTGCCGTCAGGTGACCATGCTACATTCACCACAAATTCTACTGGTGAACAAAGGGAAAATGGAGCGCCAACAGCGCCATTG
CAGCCCCCGCAACTGAAAAAGAGCCCCCTGAAGAAGGTGTCCAAGGAGACACTCAACCGACTCGCGACGCCGCGCGTGGCGGTCGCGAAAGTGACCGATG
GTATGTGATTATGCCGTTATTCGATTGAGGCGGCAGCCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATGGTGACAGTCGAACGCCC
CAACACGGCTGCGGCTGCGAGCCGAAACCATGGCGAGACATCCCAGGACGTCGCATTCTACCAGGATCTCTATCGCAAACAGGATAAAGCTCGGCTGCAC
CGAGCGTTCTCGCTGCCTGCCTTGAACGCAGAAAACCTTCGCGCTGTGCGTCCACTTGAGACCGAATGCGAGCCCGTGCTAAGGATGAACCCATCATGCT
CATACTCTTTTGTTGTTGTTCGCAGCTGACGGAGACGGATTTGCTGCACAAGAAAATGCAGTTGCTGCAGCAGCTCCACGGAGTCGTCTCGCAGCAGCAG
GAGTGCATCATCCAGGACGATCAGTGCACCGTTCGCTCGTCTGTCTCGAGCTGGAAGTCGTCCGATTTCACGAAATCCACTAAAGCATAAAGAAAATCAA
CGACATTGGCAATGTAACCTCAAATAGTAACTGTGACTTTTGCAGCTCTTGTATCATTGTTCAGACACTGACATCCAGCCGGTTAGCTGATTCAACATTG
TTGGACGTGTAGCTATTCGTCTTCCTTCTGGGGAGGAGGTCCGCACGGCTGCAGCATCTTTTCGAGCATATTGAACTTGACGCGACCGACGGCTTCGTTT
TCAGCGGCCGCGAAATAACTTAGCATGTCGTAGTGGCCCAAGTGCGACGCCAGCGTATCGCGGTGCTGGTTCACCGCCCATTCACTATCCGTTCAAAAGA
GGCACACGTGCACAAAGACAAAGATCGTTAGCATTTGGTCGACATGCTTTTATAGGGGTGACAAGATATCGGACGCGTACAATTTGGTGGTGTCAGCATG
GCCCGTGCCGACGTACTTGGCCTGCAGATGCTCCCACTGTCGGTTGATGTTGAACCGGTCCGCCGCCTACGACAGCCACATAGTCCAGCGTCAGCCTTCC
TGCTACAGAGCCATAGAGAGAGAGAGAGAGATGTAACGATGCGCCATGGCGACTGCATGTACGCACCATTTCGCTTGTTATGCTTGCCACTTTTGGAAAG
AGCGACAGCGCCTTTGATTAATATCCAATCATGTACATTTCCTGCATTTATTTAAGCCAATAATATAATCTTAAAATAATGTCACCAATTAACGAATGAA
ACAGTATTTATATCAAATGAACGGTGTCTATTGCAAGAAATAAAATTTTATTTTATTTTTTAGCGAGTCAAAAATTTGTTGAGTGGACCACAGCGTAAGC
GTATGTTGGCTAAATTTTAACCAATCGAAGGCCAATTTCACGGTAGCTGAATGGACTCAGATTGAGAGGGAGCGTGAACGGCAAACATGAGTACTGTGTT
GGCTGCATCACTTGGGTCCCT