Description :
From Genome Similarity Track
Location :
Scaffold_322:8369- 20569
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_322-snap-gene-0.5Dynein heavy chain

Sequence
12200 bases(100 bases per row)
TGCTACGCGTCCTTTTGCATCACGAGCGCCAGTCCAGCGAGCACCCACTTGTGCTTGGGCGCGAGCGTAGTGAGCGAGGCCAAGAAGACGTACGTGGGGC
CGCGCTGCGTGGTCTGGTACACGGGACAGTCCACAACGCCCTGCTGGCGCCGGAAGTAGCCCACACCCGTGGCCTCCCATTGCGGCTCGATGGCCACGGC
GCGCGCGTAGAGCACCGGCGTGACCGCGAAAAGCTCCTTGGGCGTCGGGTCCGCCACGTGACCACCACAGGAGACGCCGTCCACTTCGTATCCATTGGAC
GTCGTACCCTTCGCGCCAGTTTCACCACCTACCACCGAAGGCGGTTCCCAGCGCCCGCCCTCCAGAAAGAGCCCGTGAACGAAGGCGCCTCTGTCCGGAT
ACGACTCGGCGGCCTCGGCGCTCAGCATAGTCGTGAAGTGCGTCTCGATGGTGAGCGAGTCGAGCGCGAGGCCGTGCGTACGCGCGGTGCACTGCTTGAT
CGCCGTGAGGAAAGCCGTGGGGTTGAAAAGACCTGCGATCCAGACCGAGTACGGCAATCGGAACTCGAGCGTCCAGGTCGCGACAACACCCGCGCGCTCG
ACGAAGTCCGCAAACCAGAGCGCGAGAGACTTGCGCGACCACCACGCTAGGCGTTCCCACGAGCACGCGTGCAACACGTTGCGGCCGGGCACTTGGTTGG
CTGTCAGCGCTATCAGCAGGTCTTCCATGGCCTCCGTCATGTTGAGCGTCCCGTTGATGCCCTTGAGCAACTCCGTCAGCGTCGTGTGGACCTCGCTGAT
GAGCGCGTTCATGCGCGCAGCCTCCTGCAGCGCCACGACCACGTACGGCGACTGGTCCAGTATGAGCAGCGGTGCGGCGCGGGTCTGCAGTGTCTGGAAA
TCCATCTCGGCTGGCAGCCGGTCCAGCAAGCTCTCGACGAGCGCAATAGCGCGTGTAGAGACTATTGCTGCTACAGTCGTTGCTGTATCAAGCGAGTTAC
TGCTACTGGATGAAGACACGGGCTGAAAGAGCGCGATCGTGAGGAAGAGGTCGTTTGAGGCTTCAACGAGGTACCCGATCTCGGCGTTCGCGTGCAGTCC
GTAGACCGCCGGCGCCTCCACGGGCAGCTCCGTCTCAATGTAGCTGCTGTACTTGGAGTATGTGAACGTCATGGGGTCGGGGCACTTGAAGCCCACAGTG
AGCTCCTTGCCGCTCAGCAACTCGGGCGTGAAGATGCTGCCCAGGTACGCGTTGTTCGTGATGCGGTCCCAGTGGTCTGTGATGTGGCCGCCGTACATGA
TCTCGCCAAAGATGTACCGCAGGTCGTCCCACGGCAGTTGCTGGTCCTTGGACTTGCTCGAGGCCGAGCTGTCCAGGTATCTCCGCAAAACGTCCGAGCA
GATGAGCAGGTCGCCCGTGTTGAAGCTGTACATGCGACTCCAGCCCTGGAAGCCAAAGCGCCGCCGTCCCAACACGAGCGCGTGGAAGAAGCAGAGCGCA
AAGAGACAGCCCTGGAACTCGCTTGGCTTGGCGCACTCCTCGATCTGCTTGAGTGAGAACTGAGACCATGCGCGACGCAGGTTGCTCTTCAGGTCGGTTG
GTGCCTCGTTGGCCACTTTGATGCAGCTCTGAAGCAGCGACTCGGGCAAATTCGCCAGCGAAGCTAGCCCCGGGGCTTCAGCGGACAGGAAGCAGCGGAA
GTTTTGGTCCGCAGACACTGAGTAGAGCTCCAACGTTCGCTCGAGCTTTGGCAGCCACGACTGCATCAAGTGGATGTTTTGCAGGATGACCCAATTGCCC
TCGCGCGAGAACTTCATGAGCATCGAGTCGGCCATGGCCTCTTGACCCTGGCCCATCGAGATGTTGACCAAGTTGCCTCGCTCGTACGTGAAATCAAACT
TCCTGCCCAGATTCTCCACCCAGGACGTCGGGTCGACACCTGGAAAGAGCACAAAGAACATGGGCGTCGAGGCGCTCGTCTCCTGGTACGCCGCTTCCAT
GTCGAACGGCGGCTGCTGAGTGAACGACGCGCCCAGCTGAGCGCTCAGGAACACCTGCAGTGCTGAAATCATGCGGCCCGGGCGCATCACGCGCACAATG
TGCAGCAACTGCAGAGGCGTAATGGATGTCTTGTAGGGCCCAGGCAGCGCCTTTGCCTCGGGTTTATCGGAATCAAACCACTCGCGCCACTCTTCCGCAT
CGGATTTCATAAAAGTGGTGAGTTTCTGGAGACTCACGACGTTTTCCTCGAGCTTACGAATCCGCAGCCATGTCGTGTCGCTGAGCCACTCGCTTAGGAT
GCCCATTCCGGGCCCACTGAGGTCCGTAGACACACTGACAGACACTAGTTGCTGAATGTCGAGCGGCTTCATCTGGTTCTCTGACTGCAGGATCGCAAAG
CAGAGCTGCGTCGCGAGCGTAAGCTTGTCTTTCTCAAAGAAGCCGCGCCGGATGTAGTTGAACACCACCTCAGTTATCGATTTCTTCAGTTGGGAGCACC
GCGCTTCGATCTGCGCGGCCGTGGGCATCTCTTCTTGGTCTGTCTGCTGCAGCATTGCCTCGAGGTCTTGCTCACTCCCACCGCTCCCACTGGAGGAGCT
GTCGACCACGCGGTCTGCAAGCAGCAGGTCTGCGTTCCACTGGAATCGCTGTGTCGCGATCACTTTCTTAGCTGCCGCTTTGAGTCGCCCGAGCAGTCCA
CTGCCAGTCCCTGCGCTACCGGGAGCGTCTCTGCTCTTCTCACTCACCACCAAGTCAATGCCACGCTGGAAAATCACCACGAAAGCGTTGAGCGAGTACA
CATAGTACGAATGCATGCGCGTGAGTCCATCCATGATGAAAAAGAGCAACGCGCCACGACTTGCCACAGACTGGTACTTGGAGCTCAGCTCGTTAATCTG
CGCCTCGTACTCTTTTGCCTTGGCGGACTTCATTGCGATCTCCACAGCCGTGGCCTTCGTCGTCTCGAGGTCTGTGATCATCTGCACGCTCTCTGTGATA
TCGCCCTCTGCGTCTGCCAGGTTGGTCAGGATGCGGTCTTCGAGCGCCTGGATCTTGATCTTGAACTCGTTCTGCTGGTGCATAAGCACGACCCGGGCCT
TGGCCTTTTTCGGCCACTCCTTGCGCACCACGAGCGACAGGAGCTGGTCCTCGAGTCCTTGTTGCGTCACTGAGAAGTTGATCATCGTCGCCTCAGCTTG
GAGCTCTGGCGGATAGTGCGGATTCGAGAGCTTCGTGTGCAGGTACAGCTTGAACTCTGCGTGGAGTTCTACCAGCTTGTCACCCAGCTTGAGGAACGTC
TTGTGGCCTCGAGTAGTCGTCGTTCTCGAGATGACTGGCCAGAGACACACTTCGATATTCTCTGTCATGTTCTCCACCAACAGCGAGTACCCATGTTCGA
TCGCGGTCTCCAGTAGTTGCGGTAAGTTGGGCTGATCTTGGCGCACCACCTGGAAAGAGCTGGGGAACGCCCGGCGCATGTGCTTTTCCATCTCGCGAAG
CCAGTAGATGCCCTGGAGTTGTGGGTCGATGAGCAATGGCCAGCGCTTGCTGTTGCGAAGGACTGCGCCATTTTCAACGGACACGCGGTCGCTCGGGAGG
CCTCGCGTGCTCCATTCAGCGATGTCCGAGTCGGTCGCCAGGATCTGGAGCGGATTGCTCGCCTCGGACATTCGACTGAGCAGTGAGGAGTCCTTCTTGA
CTGGATCACTGCCCCCCACCAAACATTTCCTGAGGAACGGGATCCACTTCTCAGAGATCAGCAGGTCGCGGAAGGGCTTCGTGAATGCGCCAATGTACGA
AACGAAGCTCGCGGCGATCAACACGTCGCACACGAGTGTATCTGCTCGCCGCTCAAGCTGCTCGAGCTCGAGCGTCCACCTCACACTCTCACTGCCCAAT
GCGGCCGTAAGGCGTGTCGCGAGCTGAATGCGAAGGCGTCCTCTCTCCACAGCGGCGATGGCGTCCTGAACCGCTCTGTTCGTCTCGTCATATTCTTCCG
TCAAGAGCGCGAGTTTCGCCTCGAGCGCCGCGAGCCGCTCGTTCACCTGCTCCATCTTTTCGTTTGCAACGAGCAGCTTCTCATTCGCCTCGGCAAGTGC
TTTCTTCTTTGGCTCCACCACGACGATTGCGTCGTAGTACGCTACGATGTTGATCACCCAGGCGCAGAGCCCCGCGGAAGCGGAGTTTTTCTTTTCGATC
GTCTCGACGTTAAAGTGCTCGAGTTGCAGAAACGGCCGCACTTCTTTCCAGTTCACCTCTGGAACCTGCTGGTCGTCAACCTGGCTCTTAAAGCCCTTCA
GCTCATCCACAAACGCGTTGATGTTGCCGAGCAGAGCCTTCTTCGTGGCTTCCCATGAGCGATCCTTGTCCTTCACCTTGCCATTCTTCTGCACGATCAC
GTTCGGATTAATGCCTGCGAAGAGCACGACGACAGCTCCAAAGACGTCCCCGACGCCCACTGGAGGCTTCGACATGGTCTTGCAACTTCCGAGGTCTTTC
TTGTTGAGCGTGTCGAGGGCGGCCATTGCGGCGTCCACCATGGGTTGCGCCTGAGCGAGATCAGCCTCCGTATCTGCTTTCTTTGTCGAGACGTCGGCTT
GAATGATCGCACACTTCTCGCGCTCGATGTTCGCCTTTGCGGTCTCGCTCTCGACGACCTCCTTGTCGTTCTTGAGTCGCTCGGCGAGCTCTTCCGCGAT
CGCTTTCTTCTTCTCTGCTTCAGCAAGCGTCTTGGTGAGTTCGTCCTCCATGTTCGCGACCACATCTCGAGTCGCCTCCATTTTCTCGACCCCGCTCTGC
AATCGATACATAGCGCGCTCGTGGTTCCCATGCTTGCGTGCGAGAAGCTCGCGGTACAACGACAGACACTCGAGGTACGACTTTGGCGTCGAGTACACGT
GGCGGCGCTCGTGTGTGAAGAAGTCTCTCGCCAGGTCGTTCGTGCTCTGGAACGCGTAGGGCATGAAGTTCTGGATCGCGATGAGCAGATCGTTGTTGCG
GACCCATTTGCTCAGCTGCGGGTCGTTGTCCACGTTCAAGAAGCGCTCTGCGACCGAACGAAGTGCGTCTTTTGGCCACGGCTGAAACCAGTCGATCGAC
GTGCAATTTACCAGCGCGGGGAACTTTCGCGCGCGCATCCGGAACTCTGTCGTCGCGGGTGAAAAGCAGAGTACAACGTGCAAGTTGCGTTTGATCTCCT
GGATGAACCACTGCCAGCAGCGCTCTTTCTCCGAGACTTCACTGCCACCAATTTGCTGCTGAGTTGTTGCAGATGCGAGCGTTGCGTTCACCTTGGGCAG
GATCTGCTGCGTGATGTTCGCCTGTTCATCAGCGTTGTAGAGATCTGGGATATTGCCGCTCGACAGCAGGTCGTTGATAAGCACGAGCATGCGCTCCTTC
TTGATCTGGTTATCGCTAAACAGGAAAACGAGTCCCTCGCCCTTCACGCCAGCCTTCGTGAACATATTTTGTAGATCAGATTTGAAATCCAAGAGCGAGT
ACGCCTGAGTGATCGTGATCTCCACCAGAGCGTACTCGCAGATGAACGTCGCGAGTCGCGAAAGTGACTTGCGACCGCTGCCGCCCACGCCGACTAGCAT
CGCGTGGCCCGACGGGTTAGAAATGATCCGCACGATGCGCGCCACGTGCTCTAACGCGTCCTTGAAGAGCACCAAGTCCATTTTCGCAAACAATTCGTTG
TGCTCGCTGAGTGCCTCTTCCACAGTCGCGTTCATGCTCTGCATAGACACCACTTGGTCGTACTCGCTCGTACGGAGGCCGTTTGCAAAGTGGCAAAAAA
GGATCGGGTCCGATGTGATCGAGGCACTGACCCCACCCGCAACATCTGCAGACTGGGATGCCGATGCAGACGTAGGGATGAAGTACCGTGTAAAGTTGAA
AGATGGGAAGCATTTCCGCGCCTGCTGCTGAACGAGCGCCGTGAACTTGTGGAGATCTTGCGCCGAGACAAGGCGGTCACCGTACACGCGCATCGATTCG
TGCACCCAGAGCAGCGCAAACTTGACCGGGTCCTCAAAAGTCGACGGCCTCGCCATGAGCAGTCCTTGGAAAACGTTCGAAACGTGGCGAATGTTGAACT
CGTAGTGGAAGTTCGCCGCGGTTTTACGGAAACCGGTCGACACCTGCGTATGCAGCCCCAGCGACGCTTTTAGGATCTGCGCCGTCATTTTCCGGATCTC
TTCGACAAAGTCAGCGACGTATCCCTCCAGGAACGTCGTGTAGATCACTTGGAGACTCGCGACACTGAGCTGCGCGAGAGCAAAGGTTACAAAGTGGCGC
TGCAGGCGTGGATTGATGAAGAAGCTGCCCGCACTCGGGTTCATGCAACTTAGGAATTGCACGTTCTGGATCTGCTTCAGCGTGAACTTGGTGCGGTCGT
ACCAGTGGCCGTAGTCCAGGTACTGCCTCAGTAGTGCGAGCGCACTCTGCGTGTTGTACGAGTCTACTTGCGGCAGGTTGATGTCGTCGACAAAATAGAT
GAGTTGACTGCCCACGTTCGGACCGAACATCATCCCGACGCGCTTGCTAAGCTTGGACTCGAAGATGAGCTGCAGAGCGCTTGCGCTGGTGTAGTAGTTG
AAATTGATGCTCATGCTGGTGCAGCCACCGGCGCTTGAGCCGTTCTTTGTGGGGCTCTTTGAAGTCGCTGAGTAGTTGTCGATGCTGGTGAGCACGCCCT
GCACGAGCTGTGTTTTCCCTGTTCCAGCGTTCCCACAGAGCATGAACGGGCGTTCTTCACGCACCATCAAGCTCATCCAGTTCGTGATTGATGCGGTCTC
TGGGGTTGGCACGGTGATCGACGACATTGCGACCGATCCGTCAAAGTGCACAGGCTTGAAGTACGGAGACGACCGCCACGAGTCAAAGCCGAGCGAAGTC
GGGTTGAGCCAGTAGTCGAACACGGTGTCTCTGGTCGGAAACTTGATGTGCTTGAACTCGGAGCGCCACCACTCGCTGAAGATCTTGCGGTAGTCGGTGC
CATCGTCTGTGATGGTCAATGCTGCTCCGAAGGCCCACACAGAGATGAAGCCACTCAATATGTCGACTTTCTTCGGGTCTGCGAGCGCCTCCGCATCAAG
AATCGCATCCAAAAAATACAGGTATGTCTGCACCATTGTGATCTCCTCCATGGGCACGATGGTCTTGCAGCTTTGCCTGACGAAGGCTACGATCGGGTCA
ATGTATTTATTCATGGCCTCGCCCAGGGAAGCTCGCTGTTGCAGAGTGGCACCTTTCGTGCTCACCCAGCTTGCTAGAAATGACTTCCACTGCGAGCCGT
CGTCGTTCGAGATGTAAAGAATCCCGGCCCGCGAGACCGTTGCTGGGGTCGCAAACTTTAAGTCGCGAATCTCAAAGAGCAGTCGCATGTTGGGCTTGAG
CGGGATACGCTCGTTCGACGCGAGCGTGAGCATCTTGTTGTCGTCCATGACTGAGTTCATGGACTCGATCCAGTTCGCGTCCAAGTCGCCATCGAGCACG
ATCCACTTGGGGCGAAGGTCAGTCAACGAGATCGTCGCGACGTCTCGCATGAGTTTCGAGAGCAACCCATCTCTCCACTCGCGCGTGCCAAGCACCATGT
AGCCATAGAGCTCCTCTGTAGACACTGTCTTTGGGTTGATGTCAATCACTCGGGTCTGGTACTCGTCGCCTTTTTTCTTCCTCGCAGCGACAAGCGTCTC
ACAGCACTCGGTTTTGCCGCTGCCCGCTGGCCCCATGACGAATACGCAGTGCCGGATCGCCAGCAGCTCCTCTAATTGGATGACCTTGAGACGGAACTGC
TCGTGTGGCCATAGACCGCGCTCTTCGCAAGCAATGTGCACAAACTTCTCCATTGCTTCGTCAACTTTGCGCGGCGGGTTCATCTGCGGGAACAAGTCCT
CGAGTAGGCCATTGAAGACCAACAGATCTTGCTCAGCAATCTTGGGCAGATTAAAATCACGGAGCGAGCGCATGAGGATCTCCTGTTCACTGAGCTTGGG
CTCTGCCCGCTTGAAAGCCCCAGCTACTACAAGCACGCTTTTCACGGCGCGTAGGCCCCAGTCGTAGTGGTCTTGCTTGGAAAGTAGCTCTTTCAGTAGC
GAATAGAGGCTGTAAAACTTGGACGCCAAGAGCTTCGCCTCCCGGAATCCTTCTGCCATGAGCATGTTCTCACAGATAAGGACAAGATCGGGAGCCATCA
CCGTAATCGGTCGAAAGAGAGCCTTGAGGCCTTCGGGAAGCTCCGAGCGACCAAGGTAGCCCGGATTCATCGTGATGAAAGTGCCGCACGTCACGTCCAG
CTTGACTTTGTCACCTTCGATCGTCACGAACTCGCTGTCGCTTCGGATTCCGTCGCACACGGCCTTAAACTGCACTGAGCAGACCGATAGAACCTCGGGA
GCCAAGCGGTTGAACTCATCGAAGCATCCCCACGCGCCAGCACTTGCCAGACCTTTAAAGATGTTGCCCAGGTTCTTGTAATCCATCTCGGGCGAACAGT
TGAACACGTAGCAGATCTTTCCCACCATGTTGGCGAGGTCTTTTGTCGTCTCGGTCTTTCCTGTTCCCGCGGGGCCAGCCGGAGCGCAGCCCATCTGGAT
GTGGAGAGCCTGCGTCGCCGTGACGTATATCCGATCTGTGAGCGGAGTGATCACGAGTCGAGGGCCGTTGCCCAAGTACTCAAAGCCGTAGTCAAACTTC
GCGTCGCAGATCTCAAGAAACGTCTTGTTCAGGTGACCCGCGCGTCGTTGCTTGAGCTGCGACTGCCAAACAAAAGAGCTGGGGGTCGTGATACTCTCAT
GGAGCAACTTCTGGACGACGTCTCGCGCGTGAGCGTCAATGGTGATCACGCACATGACTCGCTGCCTGTCTTGCTTTGTGAGGTTCGTTTGCGTGAGCTT
GATCAGATCGGTGAGCTGGATCACAATCTTGTCGTAGTACTCCTTCATCGCGCTTGCATGGCCATTCGTCATGAGAACAAATGCGTTCTCAACGCCTTTT
GCGTACTCGATACCGACGATGAGCAGCGCAATCTGAGCAGCATCCATCGGCAGCAGGGTCGAGTCACCATCGCTGGACTGAGGCAGCTTCTGCATGAGCC
AGTCGACGCGGTTCTGTTCCGGAAAGCGCAAAATTGAACGCACTACGTGCTCTCTTAGCGTCATCAGCATAGCTTCAAGCAGTGTCTGCAGATATATCTC
CACTTTGCCCTGCAGTTGCACCTTTTGCTCGAAAGGGATCTTCTCCTTTGCCATGTCGTTCGAGATGAAGTGCGTCGCTGCCGTTCCATTGTCACTACCT
CCATAGCTACTGAGCTGCTTCTCGAGCGTCAGCGTGCGCGTCGCAAGGAAGACTTTCTCGATGTGACCCAGGATGTTCGCTGGAGTGCCGCCGTTCGAGA
GTAGATCGAGCAGGTCTGCCTCGGAAATGAAGTAGAAGCGAGGAAAAAGACGTCGTTTCGAGTCCAAGTACTCCTTTAGAGCTTGCTGGCACTTCTCAAG
GAGCATGCGGAGGTCGTTGAGCGACAGCAATAGATCAGGAAGCTGGCACGCGAGCAGCACGTTGCCACTGGACAGCTGGGACCACATCAGATGCAGTGTT
TGTCGCACTCGCTCGTCAATTTGCTGGAAGCGCACAGTCTCATCAGGTAGCTCGCGCTTGACTTCGTCGGACCGCATAAATAGCGACTCTAGGTATGACC
AAGATCGCTGGATTTCGTTCAGAACGCCCATGACTTCGGAAACGAGCATGAGCTTTCCATACCAGCTCTGTGTCTGCGCCTGAAAGTAGTTGTGCCTACC
AGACACCATTGCCTGCAGCAGAAGCTGGTCGGATTCGAGCATCTCCATGACATCTTCGGACAGTTGCAACAGCGGAACGTCGGTCTCTTTGTACTGCGTC
ATTGCGAACGAGACAGTCGCCCACCGCGCCTCGAGATCCTGGAGTACTGATTCCTGTTTCGCCTCTTTCTGAGCGCGGTCCGTGATTTCTTCAACGTCGC
GCTGGAACTCGTGAAGATTCAAAGCCAAAATGTCCGCAAATTTGAGAGTAGGGTTGTCGTCGGGGCAGTCGAAGTTCGTCTTGCCCGTGACAGTCGCAAG
CTCCTGCCAGTGACGTTTTCGCATCGATGGGTGACGAAGCGACTGGAACAGTGGGCACGTACTGAGGAAGTCTTTGACGAGTCGCTCAAAGTGCTTGTAA
GCGTCACACTCGCGGATCTCCTTGTTAGATGCTTTCACGAGCACCATGAATGCCTTCGCTTCTTCTTCCAGCACGATGCCATCGATCATACTCCACGGAA
CGTCCTTTGAAAGGTCGATTTTGCGCGTCACGTCTGAGATCGACTCCCACAGTTGAGTGGCGTGCTCCAGGGTCTTCCGCGTCGACATTAGCAACTTGTC
GCACGGCTCCATGAGCTCTTCACACTCCAAGATCTCGGCGATGTGACGCTTCCTCTCAAAATTGGCTTCTTCTTGATCAAATGCCAGCTTTTCTTGACCA
ATTGCATCCAGAGCGGCTTTCGTACCGATCACAAAGCTCCAGAAAGTCCTGGTTTTCAGCTGAACCTCCTTCCGCGACAGCTCGTCCACGTAGTTCGCCA
TCTCAGTGCGAAATTTCAAGCTCTGCACTGCTATCAGAGGAGCGATGCGCGCACTCGCAGCTGGCACCTTCCGTTGGATCTCTTTCCACGCAATCTCGAT
GGCGTTGAGCATCTCGAGCTCTTTCGTGACCACGAGGCCCGCATCTTTGAGAAACGCGATTTCCGCTCTGAGCTCGTCTATCGAGAGAGTGATGTCTTCG
CCGCGCTTTTCGACATGGAACACGTTCTCCTTCAACCCGATGAGCGCGTTTGTAGTCTGCTCTGGGGTCCAGGATGGTTCCGAGAGTGGCTGCTCGAGCC
CGATGTTGCACTCTTTGCTCGATTGCTGCAGCGCCTGGAGATCGTGAAGTACTTGGTCCAGCACGAGCTTTCCCGTCATGAGGTTCATTTCGCGAGTCAC
AGTGTCATCGAAAGACACAATATGCGGCGAATTGCGAATCGGACCAGCGACTCCACCGAACGTGCCCTGGAAGTCGATGTTGACTTTGAACTCGCCTGCA
TTCTGCACAGTGTAGCTCACGAGGTACTTGCCATTCATCAAATCTTGAATCTGGAGTGTGGGGAGGAAAAGCGGTCCGCCATCTTCTGTGATGACCTCGA
CAGAAAACTCGTCACCTCCACGAGTGCGAAGATAGCGATCAGCATCTCGCGCTTGGATGATGAAGCAGATAGGCTCTCCACTTGCGCCGCCACAAAGCAC
CCCGGGGCCGTATGCAAAGCACATGGACGCGTTTGTGACAGCAAAGAAGTTGAACGTTTGGAACGTGGTTGTGAACGAGTCACCTTGAAGCGCGACACGA
ATCTGGACGTCGCCCGGGGGATACATGGTGAAATCTGGCGTGGTAACGTTGAGTGTATGGTCGTTCACGTACTCACCCAAGATGTCTATGGAACCCTTGC
GACACGAGAAGCGCACGGTCACAAGCTTGTTGACGAAGTTGATGCCTTCGAGTATGAGCTGCGTCCCACCGGTGATTGGGCCGTACTCGGGAAAGACGCT
GGTGATACCGTATGGCGGGCCAACGACGCAGCTTACATCCAGGGAATAAAGATCGTTTAGCCAGACGTTCGCCCAGCCACCAAAGATGATCAGCCGGCTT
CCTTTGTCGTCGTAGGCGAGCGTAGTATCGGATCGTCCGCATGGTGGGGTGCCTCGAATTTCAGGAACACTCCAGGTCATGTCGCCAGTGTCCAGCACCG
AGATATCGTTCATGTACGTGCCTTGACCGTTGTAATTATTGGCTTCGCCAATGACACCGCCGAAATTGAACACTTTGACATGCGGGATAGCAAGCACTGC
ACACGTCGCGTGGTTCCAGCGCGGCAACGGGTTCGCCATCTGCGCTCCTTCCAGCATCGTCCACGAATTGTTAGTGGTGTCAAAGATATGGAGGTCGTTG
AACTGCGTAACACTGTTCCATCCTCCGCAGACGATCATCAAATCCTCTACAGCGCACGCTTGATGGCCTGCTCGTTTCTCTGGTGGACGACCTTTGCTGG
TGACTTTGCTCCAGCTCATATCTTCACATCGCAACATGTGCAGATCGTCAAAGTCGCGACGTCCGTAACCAGTGCCGCCGTAGCCTCCGAACACGTAGAT