Description :
From Genome Similarity Track
Location :
scaffold_43:83672- 90502
Transcript NameFunction/comments
Pl_111317hypothetical protein PHYSODRAFT_349212
Pl_111318hypothetical protein PHYSODRAFT_552366
Pl_111319conserved hypothetical protein

Sequence
6830 bases(100 bases per row)
TCTGAATCTGAGTCCATTTCTGATACCATTTTTGAATCAAAGTTCTGATATTACCAGCTTTGATTCATGCTGCCGCGAAGTAAGGGGAAGGAGGACGATG
GCGCGCCAGGAGCTGACGCTGCTGCTACGATCTGCGAGCTGTGCGACCTGTACACGCGCAACGACCTGGATGGCAAGTGGACGGAGCTCGCGGAAGTCTA
CGACGTACGTTACCCAGCGATTGGCATTGCTAGATCCGACTAACTGTTTCTTGTAGCAACGCCGCAATGTCGACAACTTCCGCGAGATTTTAGATCTGAG
CGCACCCAGCGCTCGCATGGGCGACCTCAACGGCTGGCACTTGGAGCGTATGGCCGTGGGTGAGTTTGAACCGGGAGCAGGCGCCAGTGCCAGTGACTTA
GCAGAGATCAAGCGCGAGAGTCGACTGATCAAGGAGACACTCATGAAGGTGATGGCCAATGGACGAGACTTCCAGGCCAAGCGAGACGAGCTGCAAGCAG
TGATGACGAAGCAACGTGAGGCACTGACGCTTGAACTAACAGAAGCCAAGGAATTCCTGGGCCAGGCACATCTACTGAACGCCTGTGACTCGGCGGCAAT
TGAGGTTAGTGAACCAGCACCTGTGGAGGAGCGACTGCGGGCTACTGTGAAGCACCCGGAGCTCTCACCGACGGTTGATCTCAGCGAAGCGCCATCGATT
TAAGTATGAGAATGAAAATGAAATAGGACGATACACGAGTGCATTCCTCCAGTGCTTCCCAAAGTCGGTCACGCTCTATCTGTAACTCGGTTTCGGGCAC
TTCACACCTTGCTCGCCCTCCTGACTGTCTGTACGTGCCATCCATCTAACCGCTTCTCTAGTCCACGTGAAGACGCTCCTCAAGGTACTTGACAGCATCC
TTCGTGATGATCAGCAGGTCCTTCTGAAGGATCGAGTAGACGTTGATCTTGTTCTGCGGGATCGTGTCCACGTACGGGATGTTACGCGTCGCCAGCACGA
AGCTCGACTCCACCTCCTCACCGCCCACGAACAGCGCGTGGTCCCAGCCACGACCGCCCAGCAGCTTCTTCATATCCTTTGTCTTGGTAACCTGCTCCCA
TCAACAATCCACATCATAAGCTCCAACACCCACTCTGCACTCAACAACAGCAACGTACATCAACGTCCAGCGAATCCACAACTGCCAATTTTCCCTCACG
AAGCTTGGTGGAGAGCGCCACGCGCAGGCCCATGGCGCGCACCTTCTTGGGCAGGTTGTACGAGAAGTCACGCAGCACGGGGCCGTGAACGCGGTAGCCT
CCGCGCCACTGCGGCGCACGGATGTCGCCCACACGGGCGCGTCCCGAGCCTTTCTGCTTCCACGGCTTGCGCGTGGAGCCGCTCACCTCGGAGCGCGTCT
TGGTCTTGTTGGTGCCGGCACGACGGCAAGCTAGCTGCCAGCGCACCACGCGCTGCAGGATGTCCACGCGGTCGGGCGCGCCGAATACTTCACCATCCAT
GGTGACGGAGCCCAGACCCTGTGCGTCCTCAGACAGCGACAACAGCTGCAGCTCCAGGTCTCCAGTCGGCGTCACCTTGACCTCCTGCGCCGCTGGGATC
ACGCGCGGCGGCGGCATCGGCTTCTCTTCGGCCAGCGACAGATTGGCCGGCACCGTCTGCGTACTGGCCGCACGCGCCAGACTCGCACGCGGAGCCGACA
CAGTCAGCGCCGCCACGCCGCGCAGTAGTCGGTTCATGCCCACAGTCGCCATCTCCCTTTGGTCTCGCGGCTGTCGATCGATGGATGGTGTTGTGAAACC
ACCCAAAATGGGTTTTCAATCCGTTTATAAAACACAGATTTTCGCACCCATTTATGGGTGGCATTAAAACGAGGTACAGGTCACTAAACAGTTGTGCGCA
TTATCAAAACGTCGCGGGCATCTTCCCCCTCGCTTGCGGGTGAACCTACGGGCCATCGGAGCCTGATCCCAGCATGTCGACACAGCGGAGAGGCTCTGCT
CCTCGTGGAGACGGCAGCTTGGCCGCCATCTGCACACTCATCGAGCGCAGCAACTTGGATCGCAAGTCGAAGCTCGACAGTACAGGCCGCATCTGCTACG
TGCGTCAAGTCTCTCGATTTCCTTATACAATACACTAATACAAGTATTCTCTATCAATAGGAGCTCAAGAATGACCCACTACTGCTCGACAGTTTCCCCA
TGGATCGACTCATGAAGGCCATGCGGAGACTCGTGTGCGACTCGGACACATCTACGCGTGCAGGAGCACTCCGAGCGCTGCGTTACGCCATCAGCAGCAG
CGGCAGCATCAAATACTTTGTGGACCTCAACTTGCCTGTGTTTGTAGTACGCTCGCTTGAGCGGGAGCAGAAACACTTGGCGGAACGTGTACAAGCTCTC
AAGGTTGTGCGGAGAGTCATGGAGATTGATGCGGCGCAAATGCCGACGGGGCTGGTTGCCTCAATGACGGCTATTGCAGGACATAAGGACGACAATATGC
GTCGAGTATGTTTAGAGACGCTACGGGAGTTGGCACTGCTGAATGTGGAGGTTGTGGCAGAAGCTAATGGCACCAAGATTCTCGTAGATGCAATTCTAGA
GCCGTCGTTCCAGGATCTGGCGGATTCGTTGCTGATGACACTGCTGCTCATTCTGAACGAGCCATCGACACGCAAGTTTATTGAACCTTTCGTGGATTCA
CAGGTGCTGCTTGCACCGTTTACGGATACTGATTTACCAGCAGGCAATGAACGGAGACAGCGGTGGATGGCGAGTCGTAACGCCATCGTGACTATGATGC
GGTCATGGACTGGTATGGTGGTGCTTACGAGCAACCCACAAGGTTTGCAGTCACTGATTCAACTACTGGTTCGACCTGTGGGCGAAGATGTACAAAAAGC
AGTGTTGTCCACTATTTGCGAGATTTTTTACAAGAAGACAAGCTTTGACAAGTCAGCTGCTGATGCAGCCGCAGACACTCCTGCTCTACCTGTTAGTTTG
TCGAGCGCAGAACAATTGCCACTTGCAGTCAACCACAATCTGTTGGACAATTACACGGTAATTATCCTTCTGGCCATGATCCACTGTGGCATTTTGGAGG
CGCTGGTGACTCTAGGCACAGGTCCGTCTAGAGCATTGGCAGAGCCGGCGATGGACCTGTTAGCTGATATTCTGCGTATGGCTTCTCGATTACTGCCAGA
CCAACACTGTGCATCATTGCTTGCGCTTCCACGACTAGTATCGTCAACCTCACTCACGACGACTACCACGATGTCTCTCGGAGATCATACAAAGAGTTTA
TTGGAGCGACTACAGCGTGAAAAGTCGATTCGAGCTAGTGAAATGCTGGGTGAACTGGCAAATGCTGTCGGCGCTAATTCAGGTAGTATTGCCACACGTG
GTGTGTCGCTAGTCTCGTATGGTGGTAGTGGTGTCAATGGTGTGCAACTGGCATCTGAGCTGCTACGTGATACGAACCGCCCATCGAATCTGCTGGCTCT
CCAGCAAATTGCAGGTGTGGTGCGTCTTCCATCATCTAGTGGCGGTGGTGGTATTGCAGGAACTGGCGGTGGCTCTGCCAACTATGCGGTAGCGGCTCCT
TCAACACAGCGTGGCACAAAGAGTGCGACGGCGCTACTGAAGGATAGTTTAACATCACGAGAGCTGATGGTTCTCGAGCTAAAGCAATCGCTGGATGCAC
AGATGGACGACAGTACCTTCAAGGACATGCTGCACAACCGTTCACGTGTACTTACGGACAAGAATTACAAAAATTGGAACTGGGATATTATTTCCGAAAT
GCTCGAAGGCCCACTGACAAACCCCCAGAGGCTCTCGGAAGCTATGAAAACCAAGTTCTTCAAGCGTCTCTCAGGGTTTTTTCGTTGCGATCAAGGCAAC
AAGGGGTATTTCTCGAACCTGTACTGGATTCCAGATCATGTTCCTTACCTGCGTCCAGCCTGTCAGATGTATACACTGCTGCTGAACCATCCTGAAGGTC
TACTCTTCTTGAAGACTGATCGTCGTGGCCAACTGCTTACAGAGATTTCATCAGCGTTAGAGCTGGAAGCACGCCCGGAGGCTGCTATCGTGGAGTCGCA
CATTGGTGTGCTTAAGGCACGAATGTTTTCACCTGACTATGTATCACGACGTATGCTGCGCGAGTATTTCACGCTTCTGGGACTGATGAGCTCGAGCAAA
GAGGGCCTAAAGATGATGGAACAGTCAAACCTGTTCCAGCGGCTTTATGTCATGGGCACAACTAAAGGCCACGATTTCCTGTGCCGTCTTATTCTAGCCA
ACCTGGACTACTCCGTTGACGGAAGCTCCCGTAAGCTACTTCAGTCTTGGATGATGGAGGGTTCTAAGGCACTGCGTTTGTATGCAACCTGCTTGCTGCG
CGCTTTGTTGCGTTCCGAGGTGGCAGATTTTGATAAATGGGGTATTGATGCGCTGGTAACGCAGCTCACACAAGAAGAGGAAGTCGCCAAGGCTGCTCTG
AGCGTGTTGGAAGAGGCTGCCGAGACGCCCGCATGCCTTTTGGCTATGATTCTGAAGCGACCGATGAAGTTGATTCAGTTGACGGACAAGCGAGCTGAGT
CTCTGCTACTCAAGTCGCTATCCCTAGCTGAAGGGTTGAACTTTTTGCGTGATACAGGCGACTGGATCCCACGAACACTTGCCGCTTGGCGTCGCGAAAA
GCATATTTCATACGTGCATGCTGTAGAGCACGCACTTTTCCGTGGCTTACACCGCGATGCAGCTGGGCGTGAACGTGGTTCGAATAGCAGCTCAACTAGC
ACACGCCAAACGTGCTCTCCCACACCCATTCCGGTGAATGTACCCATGAAGCGAGGTGGTGGCGTCGGACTCAAACCACCCAGTGGTGGAAGCAGCCAGC
GATCTCTATGGGGGCTGGATTGGCTTTATCGTATGCCATGGAACATGGAGGTAAAGATTGTGGGACCTCCAGGAAGTGGTCCTCCGTCGAATCTCATCTT
GGAAACGTACATTGATGGAGCGATGCGCGACGAGGATGACATTACCGGCATCGACGACGAGCTTCGCATGAACTCGATCCGTGTCAAAGGTATTGTTGTG
GATGCGCGTAACATGCCACAACCTGTTGTCGTGAACTCGCAACAAACACTGCAAGCTTGTCTCTTTCTGGGTACACAACCGGTTGATCGGCGCGGCTTTA
CAAAACCTCCTCCACAAAGTAATGGAGGTTTCGTGTCAGCAAGCTCATCAGCCAGTGGCGGTGGGGCTGCTCTTTCCAGTGATACGCAGCAAAAAATGCT
GCGCGCACGTTCGGCATCCAACTCGGCTGGAGGCAGCATGGACCGTAGCTCAGAAACAATGATGTCTTCAATGGACTTTGCTGACACTGGGTCAACTTCC
GCTGACACGGCGAAGGAAGAAAACAAAGATTGGAGTTCGTGCCAGCCCGAGCAGCGCTCACCACAGTATTTGACAGCACCGGAATGCTCGTTGTGTGCCC
CTGGCGAGCGTGCTGTTTGGAACTTCCGTGTGGAAATGGATTCGGCCGCAGGCACGAACACTTCAAACGGAAGCGTAAAGCGTCTACTGCTCAAGTCCGT
CGAGTTCACACTACAGTTACTTCCTCTACGTCCACGCACAGTACCACTACCAGTACACTTGTACGGTGAATTAGCAAAAACCAGCGCTGGTTGCCAAATA
TTGCACGCATCTGGGCATTTACCAGAGTTCCTTGCATGCCTTCGCGATGCAGCGAGCGTCCCACTTGAGAAACGTGCTGCTTTATGGGCTCTTGGTCATG
TGTCCGCCACACCACGCGGTTACGATCTGCTGAACCATTACGCTCAAGACTTTGTGGAGATGATTGTGAAGCTGGCCACCGATTCACCGCTCGTGTCGAT
TCGAGGAACATGTTTCTTCGTCCTGGGTTTGCTTGCGCGATCACCCGCAGGCCGGCGACACCTATCACGCCTTGGATGGGATGCCCCGCGCGATGCGTCA
CGTACTTCTATCGCTGTCCCGCAGAATTGTACTTCGCTCTTTTTGTGGCCACCTTCCAGGTCATCGACTCCTTGTCCGTTGACACAAACGCCTCGTGCTT
CGCCTCTACAACGACTACTAATCCGCAGGCGTGACAAAATGCCCAACGAGTGGCGCGAAGTCCTGCGCTTTGTTGCTGACTTGAGCAACCACATCACTCA
AAAGGAAGCCCATGCCTCACTGAACAAGCTGCGTTCATCGAAACCGGAGTTGTTTGAAGAGCCGGTGCTACTGATGTATGTGCACGCGCTCCTGGAGAAA
TACAGCTACCGTTTAGCACTACGCCAATTCGTGCTCAACGCATTTGACCGCGCGACACTAACCGATGAGGTGCTCGACACACTGCGAATTGAAGATGAGG
AGGAGCAGGGCAGTCAAATTCATCAGCGTGTACCAACTAGCCGTGAGCTTCGGCGGCGTCGCTCGTCACCTTCCATTCCGTCGTTTACTGCGTCAGTCCA
GTCGCTGAATTCTGCGATGCAAGCTACGTCTGGTGCCTCACGCATGTCATCCATACAAAACGTACTGAGTTCTGGAGGAAACATGGGCGACACTCGTTCA
ACAATGCGGCTAAATGCGCACAACGACCCCATCGATCGCACCGTATTGCTCAAGCGCAACCGCAAGCGCTCAGCTTTCTCAGAGAAGACCATTGTTGTTG
GTGCACCTGAAGCTGCAGTGTAGATACTCCAAGCGTAGGCGGTGATATCTCAACACAACGTACGTTCACCAGTTACCTACAAGAAACCCTAGAAGCGAAT
CGGCCTCGTACAGAACTTCCACTTGTACAG