Description :
From Genome Similarity Track
Location :
Scaffold_48:83669- 86421
Sequence
2752 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTGGCATTTTCCGCATTTTCGCATTTCCGCATTCACTCCCATTCGTTGATGGTCACTCAGCGTGTGGCGCCCATACATGCCGA
CGACGCCAGTGCCTACCACAGTGTTCCATCCACGGCTCCAGCTACGCCAGGGAAGCGTGCTACAGTATTCTGCCTGGATAAAGAAATCCCCAACTCTATA
AAAACTACGAGATAAATCGAACATGACGGGCAAAGTGATGATGGTGTCGGTCACAACAGTACTGTATTTGGTTAATGCAGGACAAACATCATATCTGACT
TGCTGATCAGACCTGAGTGCAACCAGCAGTGCTGGATCGTCTCGGCTGGCAAACTTTGCCAAGCCTCGATAGACCACTCAATCTCCTTTAACATCCCAAC
CTTGTACGGCTTGTCATTACCAGTGTCCATCTCGTCTAAAGCGTGCTGCATCTTCCTAGTTAGTACATGGCGTTTAACACAGTGGATGATGCCTTGATCT
AAAGGTTGAAGCTTCGAGGTCGTATTTGGAGGCAGTTTTTCAAGGCGAATGTTGGTCAAAGTAACATCCTCATCGTTGTGCGATGAGGCATTGTCTACCA
AGAGTAAAATCTGCCTTCCCTGTTTCCTCATCGACGCGTCTAGGTCGCGCAACCACGACTGGAATACGGTCGTCGTCATCCATGCCTTCTTTGTGGACGT
GTACTGCACTGCTTCTGACTTGTTCTTGAACCAGCGAGGCGTCGCTGACTTCCCGATGAAAAGCAAAGGAAGTTTTTCACTTCCATTAGCGTTGTCTACT
ATGACTGCTACACGCAGCCAAGGAACTCGTGCTACCTCACCGACGACGCATGACGCGTCGTCACTGAAGCGAAACCCACCGCGCAGTACAAGGTGACTGG
AGCTGAATCGTACGTCGGAGCACTTCAGTACATGTAGCTGCCTCAGACCCCGGATTATCGGGGTGGATTGACGGCTCCACGTATGGGCTGTCCGCCGGGA
TTGAGTCTCCATGCATTGAGAATTAGTCAACTTTGATTGCAAACTCAAAACAGTAGTACACCGTAGTTTGGGCAAATCTACACAAATGTTAACTACCCAA
AATAAAGGTGTATGAAAATGAGGCCAACATTGGTCGGGCAAAGGTGTAGACGAGCCCAAAACATGCGAGGCGGGTTCCTGACTCGGTGCAGCTTGCCGTG
AACTGGAAACAACTCCAAGCTTCACTGACACCAGAGCCATGGACGAGACGAGTACGTCAGGTCGAGCAAGATCGCGTTTGGACTGATGTTGCTCTACATG
AATGCGGACTACTACCACGTGGTCAACAACTGCGTGGAAGGACGGGGTGCATGGACGCGCTTAGAGACGCTTTGCGACGGATCGCAGAAGGCTGGTCGCT
TCTACCTGAAGCGACAACTCTTCACCATGGAGATGTCGGGAAGTGGCACTGCCTTGCATCAAGGCAACGAGGCCCTCAATTTCAGCGCCAAGCTAAACAG
AATCCGCCTCAAGATAAAGGACGAGGACGTAGCAATCTGCTTGCTACGTAGTCCGCTCATCAGCTACGAGAACGTCGTGCTCGGCCTGGAGATGACCATA
GCAGAGCTACGGTCACAAGACGTTGTGAAAGTGCTCACAAACGAGCACATTATGCGGTAAGATGAGAAAACAACGACGGTGAAGACTGAAAACACGGCAA
AGGCGCTCAGTATCGACCGAGTATTTCGCCAATGCACGCACTGCGGTAAATTGGGGCACGTGGTTAATGTGCTAAAAGGATGAGAACCGAGGACCAAGAC
GCGGCGGCAATGGACGTGGACGCGGGGTCAACAACATCCAGTGGAGAAGCGACAGCGATGACTACGATTACGACCATGATCGAGTAAACTCGCAGTTTCC
CCGAAATGTGGCGTTTCGACGGGCAGGAATGTGTCAGGGATATGAGCGATCGACAGCGGTGCTACGCAGCACATCTGCAGCGACAAGTCAAAATTTGCTA
ACTTGCCTTTCGGTGGCCGCGGCAACAAGGCAGCCATCAAGCGTGTGGGTACTATCGTGAAACACATAATCTTGCCCAACGGCGACAAGTGCGAGATCGA
GATCAAAAACACGTTGTATGTGCCTAGCGTGAGCAAGAACTTGGGCTCGGTGCCACAGATCAACAAGCTTTGCAAGCTCCAACAAGTGTTTGACGGTGCT
GAGATGCACATTTCGAGCAAGGACACGAGTCAAGTGGTGGTGACGGCGGATCTTGTGGATATACTCTACTAGCTCCACACGCCTCACCGATCAGCAAAGG
CGTTGACTATTGGAAGAACGGTCGACCTACATCCACGTATGGGTCAATCTCCTATCGAGGTTCATGGCAAAATGGTCGAAAACAAAATAATCAAGGATGC
AAAGGTACCTGCTAAATCGTGCGGACCAAGCCTGTGTCGAGGTTGCCACCAAGGGAAGATGGCCAAAACCCCATTTCCACGCAATTGAGACAAGCGTCAC
TACGACACGTCCGAGCTGCTCCACTTCGACATCTGCGGTCCCATGGAAGAAAATTGTTGGGCGGCAGAAAGTATCTGCTGCTCATCGTGGACGAAGCCAG
CGGGTGCGTGAAGGGTTTCTGTCTGCATGCTAAATCGGAGAGCGAAGGTTGC