Description :
From Genome Similarity Track
Location :
Scaffold_84:83654- 88529
Sequence
4875 bases(100 bases per row)
ACCACACTCTACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCGCGGTAAATTCGTCCATATCTGGT
TCGCTTCCCTGGCCTCATGTCGGAGATCTTCTCGACTTCGAACTCGTCGACTTCGAGATCCACATTCCAACTATCCTCCGGTAGGAGGACTTCGTCAAAA
TCCACCCGGTTGGATTCATCCACCGAAAGACGGATTTGCGGCCGGTCCGGATATTCCTTGAACAGCTTCAGCTTGGATACGTGTACCACAGGAAACAAGC
GATATTCGGTACCTGCCGTTTCCAACTTCACAGCGTGTTCCCCTATCTTCTCTCTTACTCGGAACGGTCCGCGCCATAGATGGGCCAGTTTACGGGCGTA
TCCTTCCTTCTCTCGATCCAAATACAGCCACACCTGCGAACCAACTTGGATTTGATGTGGATGAGCGTCTTCGTTTTTTCGATCTGCTCGATCCCGTATC
GCACTTCGTAACCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAACATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTTGGTTCCTTTTCTCGGTGC
TACATACCGGAATAGCTGCTTCTAGGGTGGATTTCGGATCCCACCCATGTACCAAGTAAAAGGGGGTGTCACCCCGGATCCTGTCTTGGGCGGTGTTCAT
CGCGAAGGTGGGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGAACATACATCTTGAGCGCCCTCGTGATCGTCTGTACCATGCGTTCG
GCCGATCCATTGGCTTGGGGACGATATGCCACAGTCGTTCGCTGTCTCTGCCCCAGGATCCGGTTGAAGGCTCGAAAGAAATCAGACATAAAGCCTGGCT
CCCGATCATGAGGAATCGTCTCACTAGCCCCGAATCAGCGAAAAACACACTTCTCTTACGATTCGGCGATGATTTGTGCAGTTCTGGACGCGCTAGCTTT
GGCTATCACGTATCCGGTAAACAGATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGTAACGAGGGGATGTGATCCATGGCTATGATT
TGGAACGGGTAAGTCGATTGGACATTCCCTGGAGACTTCTCTTCGATTGTGGGTCTTCCCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGTT
GCACATTCTTGAATAGTCCCCTCCAGTGGAAACATTCTCGGAGCGTTGGTAGGTCCGACCGATTCCCTGATGTCCACCTTCTAAGCTAGCGTGATAGTGA
TGTAGGACATCCTGTTGCAAGGTTTCCGGCATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAACTAAATCTCCCACTCTTTTCGAGCGAACTGTCTCACAAAAACAC
CAAAACAGAAGATGGGGAGTATACTCCCTCTCACTAACTGGGGTGATAATGGGATGACAATATCCACATTAGCAAGATGTCGCTTTTCCCTACATCTGAC
GGAGTACTGCGATCCTCTCTACGCGGGTGAGATCCGCCCCCTGTTCTACTTGGATATCCATCAATAGGAGACCAGCTATGTGGGTCAGTGTTATCTCCGG
TGATGAGCGTGAATAAATGGTGCGAGATCTTCCATCGTGTAGATCCCCGCCTTCATGGTAGCAGACGAGTTCATCTTCCGTCTTAGTCGGAACCACTACT
GGATCCAAGCACCGCGACTCCCCCTCTTCCGTCATTCGTTCTGTTTTCATAGGATCGGGTACTCTGGTACCGGAAAAAATACCTTTTGGATCGACTTGAC
CTTCTGGTGAGTTTACACACGACGGCTCCTGTTTAGCCTGGGTTGACACTCTCAACAGGGGTCCAGGCATCCTATCCCATGGAAAGTTCGGATCCAACCG
TGGGTCAGCAGGATCCGGCGCGCCGCATTCAATTCCCCCATCAAACCGACCCTTGGATATCTAGGGACCGGCTCTGGGTGTCTCCAGCCGTCTTGGATCC
AACTCCTCATCCACTTGGATCCCCATCTGACGATCTCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGACCGATCAACCAAGGGGCCAGTTGACTCTG
CCGGGAGCTCCACCTCCCCGAGGGATTCAGTCTCGGGTAGTCGCTTCATACGCCAGATTCTGCCATTCTCTATAGCGACGAGATCCCACTGATACTTATC
CAGGCCGCCTGGGAATACCATATTTCGCCAGCCATCGACCAAATTCTTCATAGTGGTCCAGTCATAGTTTCTTGTCGCTGACATTCGTAGCCTGGAGGTA
CTGTGATCGACCTGGTCCTTGGATTATTGTAGGCATCCACTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCATTGCACCCGATCTGGCAGT
TTCTAGGTCTCTCCGGGCTTGATCCAGGTCGTCTTATCTGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCA
TCGCGTCCGGGAAACACAGTATCCCCGTCCGCCAGATCCAGCCTTACCCCGGCTGATATTATGAAAATCCATCCCCGAGGATGGCGTCTTGACCAGCGAG
ATCTCCCACCCAGATGTCAAACCAATACACCCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCC
AACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGG
ATTGTTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATTCACGGGACTCCCCGGTTAGCA
GATCCATGGATCCCACATCCTCAGATCCACGGGATCCAGTGACCTGACAGTCTGTAAGACGAGCCACAGTGCCCT