Description :
From Genome Similarity Track
Location :
Scaffold_247:8365- 9790
Transcript NameFunction/comments
Physo_144709reverse transcriptase

Sequence
1425 bases(100 bases per row)
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAG
CAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAA
ATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAA
GCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTT
TACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCG
CGGCGTCGGGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGTGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGG
CCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGA
CGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACC
AGGCTGACCAGCACGAGCGGCAGCCTCGCCATCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGC
TGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGT
AATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGTTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGAAGGGGTTACCCTGAGTCGG
ATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTCGATATGGGGCGAGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCGGT