Description :
From Genome Similarity Track
Location :
Scaffold_33:83601- 84956
Transcript NameFunction/comments
Phyra_78607amino acid transporter

Sequence
1355 bases(100 bases per row)
CATGACGGTCAAGCCCTACGGCCCGGCTGTGACGCTGGCCATGGCGCTCAACTACGTGATCGGCACGGGCTGCTTCGGACTGCCCTACGCCTTCATGGAG
GCCGGCATCGGACTCAGCCTCACGCTCATGATTGTCGGCGTCATCGGCTCGCTCATCACCATGAACTACACGCTAGAGTCGCTGGCCAGGGCCGAGGGCG
TCTGCGCGGCCACGGGAGGAGGCGCCCCTCGCCATCAGATCACATACCGCAAGTTCGAGTTCGCCACGATCGCTGACATGTTTGTGGGGCGTGTGGGCAA
GGCCGCTGTGCAGCTGGTCATGGGCCTGTATTGCATCGGCTCGCTCTGGTCGTACGCATCCGTGTTCTCGTCGTCCACGGCCTCGCTCTTCTTCTCGTAC
GTGCTGGGCGATTCGTGCGACGTGTACGGGGATTCGCCCTCGTCCGGCTGCCTGGAGGGCTACTACGTGTTCATGGCCATCTTCTCCGCCATTGTGCTGT
CCATGGTGCTCATGGACATCAGCGACCAGGCGCTCGTGCAGAAGTTCCTGTCCGTGTACCGGATCGTGGCCTTCGTGCTCATGCTCGTGACGATGCTGGT
CAAGGTGGCGAGCGACGGACAGGACATTGTGGCCTCACGATACAATGCAATCGGCCTGGTGAACTGGGGGAACTTTGGCAAGGGCTTTGGACCCACACTA
CTGGCGCTCAACTGCCAGTACAACATGCCGGACGCGCTGCAGCCGCTGAATCCCAAGTCCAAGGCGCGTTTCGTGGCGTTTGCTGCGCTATTGATCGCTG
GTACGTGCTACCTTCTGGTCGGCCTGCTCGGGGCGCTGTCCTTCGACAAGATCAACCCGCTGGCGACGCTCATGTGGAGCGATTACACGGGCTGCGGCAA
CGGATGGGAGCAGTGCGGCCACGCCAACCCGGGCGGAATCGTCGTGCAGCTCGTTATCCTGCTCTTCCCCGTCATCAATGTGGTGTCGGCGTATCCGATG
GTGGGCGTCACTGTCGGCGACAACATGCTCATGTCGTTCCCGTCGCACCTCACTGCTCGCTTTGGTGAGGGGATCACACGCAGCATGTGCCGACTGTCGG
TGGCGGTGCCGCCGATTCTGTTCGCTATCGTGTTCAAGCGCCTGGACTTCATCTTCGCGGTCGCAGGACTGTTCGGATTCCTGCTCGGGTTGACGATTCC
GTGCTGGTTCCAGGTCATCGGTAGTCGCTACTGCCAGCGCGTGTGGGGGTTCCCTGGCGCCGCCATCACCGAGTTCACAGAGCCGATTGTGAGCTCCGTC
CCGTTTGCGAGTGTCTTCCTGGCCCTCACCTTCGTCATTACTGCAGTCGCCATTG