Description :
From Genome Similarity Track
Location :
Scaffold_81:836- 2156
Transcript NameFunction/comments
Phyke_g4876hypothetical protein PHYSODRAFT_320526

Sequence
1320 bases(100 bases per row)
CTCAAGCCCAAGAGACTCCTGTACACGAGTGTTCTGGTCTCACTATTACAACCGTTCCAAAGCGGTTGGTCGACCTCGCAGATGAATCTGTCGCAGTACA
ACGATACGGCCCAGTGTAATGCTCGTCCTGTGGCTGAAGGAACGTGCCTCATGTTCCCTGGCCACTCGAAGCTAGAGTGGACATTCGCAGTGAACGCATG
GATCTTCGGTGCTATGATCGGTTCTCTGTGCTGCGGCTACTTCAGCGACAAGCTAGGTCGCAAGAAGGTTTTGATGATCAACTGCGTCTTCATGATCGTT
GGCGGCATGATCCAGGCGACCGTGTCCAACATTTGGCTGTTCGCCATTGGCCGCCTCATCGCCGGCTTGGCGTCGGGTACAGCCACAGGTACGATTGGTG
CGTACGTGAACGAGCTATCGCCACCGCACATGCGCAACACGCTGGGTTTGGGTCTGCAGATTTCCACGACCATTGGCATCCTGCTCCCAGCCATTgcatt
cttcttcgcgaaTACGAGCAACGGGTGGCGATATTTGGCAGCTTTCCCGTGTGTGCTGGGCGCGCAATTCTTGCTCCTAGCCCCGACGCTGAGTGTGGAG
AGTCCAGCGTGGCTATTGACAAAGAATCGTCGTGAGGAGGCACGGAGGGTCATTGCGCGCTTGTACGGCGAAGAGAATGTAGGCACAGTTTTGTCCTGGC
TTGAAGTGGGGAACAAGGCAGCCAACGCTGAGCTGGGTAGGATTGCTGGCGAGCCGCCTGTGAATGAGTCCATGTTTGCCCCGCGCTACCGCCTCCAATT
GGCAGGTGCAGTCTTGCTTTCGTGCACACAGCAGCTCTCGGGCATCAACGCGGTGTTCTACTACTCCGGCACTATTTTCTCGGACGCCGGTATCTCAGAT
TCGCGCGTTGGCACCTTGATCATCAACTTCATTAATATATGGCCTGCGTTCTTCACGGGAGTGCTGGCCGTCCGCCTAGGCAACCGTAACATGATCTTGT
GGGGGTTGGCAGGCATGGTGGCGATGTCGATCGGCATGACGGTGGCATTTATCGTCGATGTATCGGTGCTGTCGATCGTGTTTACAGCTTTGTACGTGAT
TGTGTTCGGCGTGACGTTGGGCCCTTTGGTATGGGTGATGACCGCCGACATGTTCCCGGATTCTATTCGCGCGAGTGCGTCGTCGCTGTGTATTGGCATC
AATTGGTTGTGCAACCTAGTCGTAGGCGTGTCGTACCCGTACGTCTCGGATGCTCTTAACGGCTACGCGTACGTGCCATTCGTGGTGCTTTTGGTGATCT
TTTACTTGCTGGcgctgaag