Description :
From Genome Similarity Track
Location :
Scaffold_509:8359- 10561
Sequence
2202 bases(100 bases per row)
TCATGGAGTATATGGATTCTGGAGACCTGCTGTCGGTTCTGCGGACGAATCCACCGTCAGTGCTGACTTGGGAGAATGGCAAGGCTACATACTGCTTACA
AGTGTGCGAAGCGGTTTATTACTTACACAGCTTTCAGCCTGCACTGATTCATCGTGATATCAAGTCACGTAATATTTTGGTGGATTCAGAAAAGGGAGCA
AAATTGTCCGATTTCGGAGAAAGTCGTGAACGTACCGTGGCGCGAACAATGACGGCCGGTGTTGGCACGGCTCGCTGGGTGGCGCCTGAAATTATATTAG
GCGAGGACTACAGCGAACTTGCTGATATTTACTCGCTCGGTGTTTTGCTAACAGAGATGGATACACACCAAATTCCGTACCAGACGTTGGGTCTCGAGGA
ATCAATGATTGTCCAACAGGTTGCTGTAGGAAAGTTGAGACCCAAGGTATCGGACACCTGTCCAGAGATCATCCGCCGATTGACTCACGAGTGTCTCCAG
TATGACCCCGGTCTTCGACCATCCGCGGCCCGCGTGCTTCAGACTCTCCTGGCCTCACCGCTGATTCGCCAGCCGTCGAATGATCAAACAGACAACTAGA
GCTGACTAAATAGCGGGATTCTGCGTTTCTCGTCAAGAATGCGATGGCATTGTTGTCACGAAGCTCCAGCAATTAGTACTGTATCTCATTTGTGTCAAGA
TTGGTGGATAAACTTTTTCCTAGATCCGTCGTTTGGCTACTCTCTTTTCCTGCTGCCGCAGATGCGATTTTTCGTCGCCTACTTTAGCGCGGCTGTTTTG
TTGGCATTGATTTAATTTGATATATTTGATGGGACCTTACCCATGGATGGTCGATCCATCCCTAAACATATACTCCGGTGGTCGTGTATAGGTGCAGATT
GTGCCGTCTCTGTCTCGCACAGCGTTTCATCTACCTTTGGCTCAATCTACAAGAAAAACAATATTTGAGATTAATGTGGCACCTTTGGAACTGCGCTATC
ACGTCTACCCATCCATGTTAGTATCGATTCCCGGTGTGCTCGTGGTGCAGCGCAGCAAATGGAGTGTACATCTGCGAAATAAAGCTGGTGCTTCAGTGAA
CATGATTCTTTGTCAGCGTGTTTCTGAACAGTTCGATGTGGGACTAGTCCGCTTTGGTTACGGAAATGACGGCGACTATAGCTGGCCGCATTTTTTCGTA
AGCTACGTTTTGCTGTCAGAATGTGCCAGCAAAATGTATTGAAGCCTCCTGAATTTTTTTGCCACTATAAACGAAGCGGAACAGTTGGGGTCGATACGAG
TCACCGAGCTCAATAGAGCTACCAAGTCTTCGCGGGATTCTGTCTTGTTAATCTAGCTCGACAGGCCATTCGGAGTTGTTGCCGACTTGCCGATGATGTG
ATATTAGTGAAATGGACATGTATTCGATGACCAAATATTATTGCCAGTGGCGAGTGACCGTGATGAAATAGCTTTTGCTCACTATAACAAGACAAGCGCG
ATGCTCTTCGTAGGACGTCGGCTGAAACAATCAACAGAAGGGGTCGCCGACGTCGTTAGGGCAACACTTGACTTAGGCTCTGCTGTGGATTACAAAAGGC
GTAAAGGCATGTGCTCCCACGACTGCAGCTGATAGTGAAAGAGCCGAAAACGCGGTGCTGGACGACTCAAACTTTGCACGATTGTTGCGTCCGAGCGCTA
GAATTCAAGATATACCGGATGTTTCAGTTTCGAATGGTAGGCACAAGCTCTGTTTCTCGACGGACTGTGGAAAACAGCGGTGTGTATTACGAAAGTTTGT
CGATGCATAGCTGTCATTTGGGGAGTCGTCGGTCCACTTGGGAACACAACGATACTAACACTAAAGGTGGCAGAGATGGAATAACTGCGTCGCTAGCTCA
ACGATGTTCGTAATATGGCGGAAGGTCTAAATTTACGGTGGGGCGCTTGTTCACGCAAGTGGTTACTGGACGTAAGTCGGCTGTTAAATCTGTTAATGGC
GCTTCTACACCGTGGACTGCTTTCATCATCGTCTTACGAGCGACAGAGACTTGACGAGTTGGAAGGGATCTTAGGTAACGGATTCGTTTTCTATGATACA
GACCGACCGGCAGCAAATGCTATGTTGTCTCCATATGGGCTTGACGTATCTTTTACAGACAGACGTGCAGTTTGTCATGGTGCAAGGACTACTGTAGTTA
GG