Description :
From Genome Similarity Track
Location :
contig_29:8357- 12950
Transcript NameFunction/comments
g7039.t1hypothetical protein
g7040.t1hypothetical protein

Sequence
4593 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCTTCACGCCACTTGTTT
TTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCTAA
GTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGT
CTAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTACCCTTCCAGAAGACCTGGAA
TTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGCTG
TCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCTCGTCCGTTGCTAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGAGCTT
CGAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCGTGCC
ACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGTCGTT
GTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCTGCGC
GGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTCTCCTC
GTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAGCGCG
AGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGG
AAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTCT
GCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACAGAAGCTCCGTGTTGCCCTTGAACGATTTGGCAGAGATG
GGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGCAATC
CACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGTGCCCT
CCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTGTTCACACAG
TAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCTGGTAGTCAAGGCTGCTACGTCGCCCCGTAGGT
ACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGCTGCCGGCAC
TTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATATTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGACGA
GATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCAC
ATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATC
TGTCGGATGATCAGATTGGAATCTCCACAGATCACAACTCGCCCCTGTTCTGATCGGACAGTAGCTTGAAGCCTAGCAGAAGTCCGCGATATTCGGCTTC
GTTGACAGTCAGGTCGTCGGCGAATTCGGACGCGGCAGATGTGATCGACCACTCCGGGAGCTTCCAGACAATTGCACTATACGCTCCGGCGCTCCGCTTG
ACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTCTTTCACCGGTG
CAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCGGATTTC
CAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGTCGAATACCTCGACAGCACC
TTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATTCGTTCGACT
TCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGACCACGATCAC
AGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGATCGTCG
GACTCCGTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGCGAAGTCTTCAATG
AAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTTTCGGATTGG
CTTCCAAACCATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTTCCATCGCTCGCA
AGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGT
CCCGGGTTTGCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGGCTTATCCGGAGGTATCCGTACAGAGCATTATCGA
TCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCTTCCGTGC
ACGTTCCGTCATGGAGACCACCCAAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGATCAGCGGC
ATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCACGATTGGGG
ATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCACCCTCCGCAC
GCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGT
CGCCGCCAGATGATCTGGCGAAGTCGATCGATCTCTTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGA
TCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAG