Description :
From Genome Similarity Track
Location :
contig_29:8356- 12957
Transcript NameFunction/comments
g5695.t1hypothetical protein

Sequence
4601 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCTTCACGCCACTTGTTT
TTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCTAA
GTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGT
CTAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTACCCTTCCAGAAGACCTGGAA
TTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGCTG
TCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCTCGTCCGTTGCTAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGAGCTT
CGAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCGTGCC
ACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGTCGTT
GTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCTGCGC
GGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTCTCCTC
GTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAGCGCG
AGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGG
AAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTCT
GCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACAGAAGCTCCGTGTTGCCCTTGAACGATTTGGCAGAGATG
GGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGCAATC
CACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCGCCAGTGGAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGTGCCCTC
CTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAACGGGTGGTG
TTCACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCTGGTAGTCAAGGCTGCTACGTCGC
CCCGTAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGC
TGCCGGCACTTGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATATTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGA
TCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATC
GCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCA
CCACGCATCTGTCGGATGATCAGATTGGAATCTCCACAGATCACAACTCGCCCCTGTTCTGATCGGACAGTAGCTTGAAGCCTAGCAGAAGTCCGCGATA
TTCGGCTTCGTTGACAGTCAGATCGTCGGCGAATTCGGACGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGGCG
CTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTCTT
TCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTT
CCGGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGTCGAATACCTC
GACAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATT
CGTTCGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGAC
CACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCAC
CGATCGTCGGACTCCGTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGCGAAG
TCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTT
TCGGATTGGCTTCCAAACCATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTTCCA
TCGCTCGCAAGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGC
ACCGAAGGTCCCGGGTTTGCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGGCTTATCCGGAGGTATCCGTACAGAG
CATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGAT
CTTCCGTGCACGTTCCGTCATGGAGACCACCCAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGA
TCAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCAC
GATTGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCACC
CTCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCA
AGTGTCGTCGCCGCCAGATGATCTGGCGAAGTCGATCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTC
GGTAGTGATCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGA
G