Description :
From Genome Similarity Track
Location :
Scaffold_15:8354- 10019
Sequence
1665 bases(100 bases per row)
AGTGTATGAGTTGGGCTCAGATGTTTGGTGTATAATTCCGGCATTTCTACATAAATGGTGACTTTTTGATCTATATATTCTTTTCCGTTGTTTTGGTTCG
AATACTCTAGATTCTGTTATTGACTTGAATTTCAATGAATGCGTTATCCTCCACAACTTTTTCCAACACTTGGCTCTTTGATTTAATATAGCAAGCGAGT
GTATCTTGAGTAATCGTCGATGAATGTTACAACCCACTTTGGGATTGCTTCTGATTTGGTCTGCAAAGGAACCATTACATCACTGTGCATAAGCTGAAGA
CATTCAAGTGTATTGATTGCGTGGTCTTTTGATCTTGGAAACGACTCGACATTCATTTTTCCATTGATGCATCCTTCATATAATTGATCATTATTCTAAT
CTTGCGTCTGACTACTAATAGTTGGTAACGTTACACTGGGAACATTCGGATAAGATCAGGACATTATTTGCATGGAAAGGTGAAAGGAGAAATATGCTAC
TTATGATATGGAGTAGCGATAAAGAAAATTTGGTACAGGCTTAGATTATCTTATTGAGAATTAAGCACCCACAAATATATTGTGTCCTAATATTAACAAC
AGGTTAACTGCCACAAATCTTGTGTTTCTCTAGCTACGAACTCTATCAAAAAAGGGTATGTTAAGAGAAGACAACTATTTCAGCAGGAAACTAAGCGCTT
GAATGCAGCTGATGTGAAAGTGATTTTTGGACTATATCGACCCGGTTAAACGCCCGAGCGGGGATGACGGATCGTAGCGAATTGAAAGGTCAATGACATG
AAGACGTTCACGATCATTCCAACCACGATCGGCCTAAACTTGCAGTCTGGCTAGATCAGCATGTAGTGTTGCTCAAGTATGGAACGTTTGAAAAACTTTT
TCTTGAGGTCTGTCCTTGCACAACGGGTGCAATAGAGTGGGTTTTACATGAGTTCAAGATGAAGAAATGCGGAAGCGTTATGAATCATTGTTTGAGGTTC
GAAGAATTGTATTTGTCAACGCAAGCAATTGGAGTGGTTTTCGACTCGGATGAGCAGCTGGTGGTATTACTTGAAAGTATGTCAAAAGCTTTTACCAGAT
TATCAAGATCATTGAGAATGTCCCAGGGTTGGCCATGTTACAAGCAAAGAAAATGCTTCTTCGAAAATCATAAAGCATCAATGCTAAGGAAAAGCATTGC
ATGACACTCGAAGCCCAGTACAAATGGCAAAGCAAAGATCGAGCTAATAGGCCGAACAAGAGCAGAGCGAAGCTCGAGTGACAGTGTTTCCGGTGCGACA
AGTATGGGCCCAAACAAGCGGTTTGTTTGAAAAGTAACAAGGCCAACAGTGAAGAAGCCCATGCCTTCACCACTTTGCAAAAATATTGAGCGAATTAGTT
TCTGGACAGTGACGCAAGCAGCAACACATCTTTCAGCAAAAGTGAATTTACCACTCACACGCCTCAAAGATAATTATACCGAGAACAGTTGCCAATGGAA
ACAAAGTTGATGCAGTAGGAGTCGGAACCGTCATTGGATGACTAAAGAATAACCGGACTATCAGAATTGATGATCTTTTGTACGTTCCCGGACCTGATCA
AAAGCTACCTTCGTTTCTGCACTGGCTGGAAAACTACTCTAAGGTCTATTTCGGAATTTTACTCT