Description :
From Genome Similarity Track
Location :
Scaffold_5:835315- 837844
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04587hypothetical protein

Sequence
2529 bases(100 bases per row)
TGAGCCGACAGATCATTTACAACAGTTACTAAGCTTAGAGCACCCGGTTTTCCTCGAGGCATCTCTCGCGCTGGTTGCGTCAGCACGGGTACGCCCGCCC
CAACCTTGCCGTTCTCAGCGAATATGCGGACATACGTCCACTGTCGCGTTGGCAGTCCTTCGAGAGTATACCGAAAGGCTCCGTCTGCAGCAGCTACCAA
CGTACTAGCTGCTACCGTCACTTGGGCAAGTGCGTCGCCGTTTGATCCGCTGTCAAACTCCGGAGACGGATCCCATTCAATCATGTAGCCTGTGACGGGT
GCTCCTCCAGTGAACTTGGGAGCGGCGTAACTGATCATCAGAGACGTAGGCCCAGCAAGCGTAAGAATCGGCGGCGCTAGCATGTTGAACGGGGATCTGG
GAGCAGACGGCGGCTCGAACGGCACACTCAGCGACCGAGGAGCTGTAACCCGTCGCGGTCCGTAACCCAGTGCGTTATACGCCCCCACACGGGCGTAGTA
CCTGTTGCCAGGGGTAAGTCCCTTGATAATGTACTCGTACGGAACCGGTGTGGTTTTAGCGTCCACGACGACCACGCCACAGTTGGTTCGTCCACTCACC
GGTACGTTGTTGACTGTTGAAGGGCAATACGTGGCTCCGTTCAGGCTTCCAACTTGGGTACCGCCAGTCACCGTAAGCGTAGCTTTTCCGCCTGCAGCGG
ATAGCCGACTCGTGTACGTCAAAGCTGGCACGACGTCCAACTCGCTCAGGAACGTGATCGTCCAGGTACACTGGTTCTTGGTCGAACAGCTGTCGCGCGT
CACAGTCACGTCGCCGACATTGGGCAGATTCTCCAGTTCTCGTGCCATATCATCATCGGACGCGGACGCGCTCAGTGCTGACGTGCTGAAGATGCCTTGG
ATCTGGCAGTACGTACAGGTTGTCGTGTCCAATGTAAGCACGAACGAGCCGGCTACACTGCCACTGGAATCTGATGCTGTGCTAATCGTTTGGACTTGAG
AAATGGTGTTCGCGAACTCCGTGTCGATCCATTCAACAAGATACTTGGTTACGGGCGAGCCACCATTACCGTTGAGATCCGCTTGTGAGATCGTGGGCGG
TGGGAACGACACGCGCAGCGAACTCACGCGCACGTCCGGATCATCTTCATCGTCGGGCGTTAGCGCAGATAGAATAACGTACGGAGACGGCGGTGGGTCA
CTCGAAGTGATCGGAGCAACCGCAATACTATCACATGGAGCGCCGTAACCCATCGAGGTGTGAGCCGTCACGCGAATGTGCGTGGTTGCCCCCATCGCGA
GGCCTGTTGTTAGCTGATAGTCGTACGTTTCCTGAGCGTCGAGCGCGACCGTCTTCCCTGTAAAGTCTCCACATCCGTGTCCTCCTACAACGGTGATCGC
AGACACCGTCGGTGCCGTAGTCGCCACTTGGAAGCTGCACGTGATCGACCCAGCGCCTACCATGATCCAATCGCCTTTTGCCAGTCCAAACGTGAGACCG
AGACTTCCGCTCACCGACAGTGTGTTCGTAGCAGTGACCAGATCGGTAATACAATTCGCACAGAGCTGACGAGTCATCCAACGCGACGGAACTTTCGAAG
CCGAAGGAGTCACGATCATCGTCTGCTTGTTCGAAGACAGAAAGTCTGCGTTCGTATCCCATTCCACGCGGAATGAGTCGATAATCTCCAGTCCCGACCA
ACTATTGGGGTCGCTGAACGCGATCATCAACGAGTTCTTCGTGAAACCCAAGACGTTCGACGTCGCGCCGACCACGCCAGCTCCTAGCAACTGGGACGGT
ACTGTCAACGTTGGCGGCGCAGGCAGTTGTCGCGTGGTTGCTAGCGTTCCTGTTGCAGCACAGGACTCGATGCCCGGTTCACAAATGAACGTGGCGATTT
GAGCCGCGCCGTACCCTTCACGGTTCTGCGCCCGGGCACGAATCGTGTACTGCTTGTTCGGTGTGAGTGGTTTGAGGATCGTAGACTGCTGGTCGTCCAC
GCTGGGCAGGATCGCGACTGAGCTGTCGGTCGTTGAGTCATACAACGCCTTCAGGTTCACGGCTTGACCAGTGAATGCGTCGCAGCCGTGCTGCCGTTCC
AGGTTGTACATGACTAGCGATCCAGTCCACGCTGTCTTTACAAACGTTGCTGCATCCTTGCTTACAGTGAGAATGCATACAGGAGACACACTACTAAGCA
CTATAATCTGTCCACTGGCCAACCCAGTGTTCGAATTGAGCGTGAGCGTCGGCGCCAGAGAGGCTGTTCCAGCTGTGAGCGCCGACACGCATCCCGTGCA
CAGCAACGGCTGCACGGCAAAGGCTGCGGTCGAGTACTCCACGAGATACTGCGTGATGGTGGCACCGTTGTTCGACATTGGGGTCTTCCAGGCGACATTC
AATGCTGTCCGATCGGCACGGTTGCTTGCCACGGTGACAGAAATCGGCGCCAGAGGCGGCGCGACTGGAGCCAGAACTGCGTCACCTGCAACGCACGGAA
GATCATGGCACAACGCCGTCGCACGCAGT