Description :
From Genome Similarity Track
Location :
Scaffold_671:8352- 10514
Transcript NameFunction/comments
Phyag_g7397myosin-like protein
Phyag_g7398hypothetical protein PHYSODRAFT_493513

Sequence
2162 bases(100 bases per row)
GCCCTCCAGCAATAGAGGCCAAATGATTCATGAGAATCTTGGTGGTCTCCGTCTTACCAGCACCTGATTCTCCACTAACAAGAATGGACTGGTTCACTTC
ATGACGCTTCATGTCGTTATACGACGCCATAGACGTCGCGTACACATGAGGCGGCAGTTCGTCCCGAGCCTTCGTAAGATAGTGAGACTGCGTCTGCTCC
GAATAGAGCTCCGGCAGCCACTGATACGGGTTCACAGCGATACAAATGTCTCCTGTGTAAGTATACGGCAACTTTTGCAGGAAGCGCTTCTTGACGTTGT
AGAGGATGGCAGCCTCGTGCAGATAATTGAGAGCCGTCATGTCTTCGATCCCGTCGGGGCCCAAGTTGTCGTTCTGATACGGAAGCgactcgagctgcag
actcttgagcagcgccttgacCTTGGGGTCATTGAAGTCCAGCACACGCTCCTCATCGACTATCACGGCGTTCACGTCGCCAGGTGGGGGGGATACACGC
AGTGTGACCGTCTTCTCGGGCCTCTTGGGGTCGGAGCTCTTGTCCTCGCGCAGGATCTGCGCTGGCAGCCACACGAACGTCTCGTCGGGCACGTAGCACT
TGGTGCCGGCGCCCGCCTCCTTCGCGGCCATCTGCGCTTGCCCTGCGTATAGAATAAAGGAGCTGCACTTGGTCACTAGTTCGCGGACTCGTGACTGATT
TCTAGGTCGtatacaaacgccaagaTAAAACTTCAAGCACGTAGCTCACTTGTGTCAACCACACCACAAACCTCTTCATTTTCGTGAAAACCTGTCTTCC
AGCATAGTTGGATCTGTTTGACACGGGGCGAGCATGGAGGCGGTCGTGCGCGAGCTCCAGAGCGACGGTGAGCGTCCGCAGCCAGTCCTCATGACCTCCA
GCCACTTCTAACCGCTTCTCTCTGCCTTTCTACGTCAATGCAGCGCAGCTGGGCGTGTTCCTGAGCCCCGAGTGCAACGtcagcgccatcgccagcTCCG
TCGTGGCTCGAGATTCGGCGCTTCGGGACATCAGCGGCGCCTCTAGACAccgcacgagctccagcaccagcttcaatGCTGCGGCCGACGACCACGAAGA
GTCCAGCCAATCGGAGCAGTTCGTGGACAAGCTGGATGGGGCTGTGCAGCGCATTGATCGCGTCATCTCGGAGCATATTGGGGAGCACCACGCGACGCTA
TTGGACCAGGTGGGATCTGTGGACGAGCTCCAGGGCCACGTGACGTCGGTGCAGAGCTCAGTGgggcagctgaagcagtcGGTGCATTCGTTGGAGGCAC
TGGTGCGTGAACAGCACGAGAATCTGCGAGACACCATCCAGCGCTATCGCAACGTGGAGCGGTGTGGAGACATTGTGCGGCGagtgctgcgcttccagca
gctttcggATCGCGTGCTGGGGTCGGAGCTGAATCATGTCGATGCGACGGCGACAGTGGAGAATGGAGTCGGGCTTACGGGGGATGCGAGACAGAACGAG
ATGGTGTCGGTTGCGCTGGCGATCAGAGAGATGGAGGTTTTGGTACAGGACGAGAGTTTTGAGGAGTTGAGTGTGGTGCGCGCTAAACTGCCGGCTACTC
ACAAGCTCGGTGCGAATTTGAAGCGTGAGGTACGTGCTGCGTTGAGGTCGGGTATCCAGAGTTTGAGCCAGGGGGACGTCGGTGACGCACTGCAGATCCT
CTTTTATCTTGGAGACTTGGCTACGACGGCGCAAGCCTCAGTGAATGATGTGATTCAGGACGTGGAACGTAAATGTACCGCTGCTATATCTGAGGAGAAA
CTTGTACGTGCTGGCGGTAGCAATTCCAACCGCTTGGAAGGAAGTATCGGACCAGCATCAGGTACTATCATGCAGAAGTCTGACCTGTGGAAAGCCCTTG
AGGATGTTTTCGATGCCATTCGTGTGCATGCTCTTCAAGTGTGGAATTTACAgcgtgtgctgctgaagatggtAGACCCGGCATCGGGTAAAAAGTATCT
TGATCTAGTGCTCGAGCTGGATGAGCCGTCTCTCTTCGCTACGTTCTGGGAGGTCACATGTGCTATCGTGCGAGAGCTATTCGCATCCATTCTCGGCTAC
AGCACAGCAGTAAAATCATTGCTGATCGCAGAATACCCCCGAATGCGTGAGCAAGCCACTCG