Description :
From Genome Similarity Track
Location :
Scaffold_769:8351- 11594
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_769-snap-gene-0.11E3 ubiquitin-protein ligase UPL6

Sequence
3243 bases(100 bases per row)
TACGTCATTTCAAAGCCAGCGCCGGATGAGATCGAGATGAGAAGCTTGGCGCGGAGCACCTTGTAGGACGAGTACGTCGGGAGCTTGAGCGTGTTGAAGC
ACGTCGAGGAGCTTGGCAGGAGCTCGTCGTCCTGGCGGATTGGGATCTTCTGGATGCAAAACGGCGGCGTCAGGCTACTGAACCCCAGTGACGGCGCACG
CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAACCACGCCACGCGCTTGTCCATCGCGTAGTA
CCCGCCAGCGTACTTTGTATTCGCCTTCAGGTCGTCGACATCGATGTGCCCACCTTTGCCCGAGATCAGCACCTGGAGCTCCGGTTCGTTGAACATTTGC
AGCCATCGGACGTCGATGAGGTCGTTGAGACCCGCGCGGAATGCTGCGCATTGTGATCGAATCTGCGTGTTGAGGTAGTAATTGGCCACCAAGTGGATGT
ATCGCGTTTTGTTATGATTGCTAACCGCAATGTTGCCACCACCTAGTGTCGTCAAGCAAAACACATACACGCCAACAATGTGAGCAATCAAAGTCATCCC
TTTGCACAACGATCTTAATCACATTTGTTACCTGGGAGCAACTCGATCTCCTGTTGATCGCCAAACACGTCCTGAACGATCGTGAACGTCAAGCCAAGGT
CCTCGACGTCACCGTCATAAGTCTTGAGAAACATGAGGTTCTAAGCCATTTGATGCAGCGGATACAGCACACAGTTAGCACTTTGCGCCGCAAACAATGG
TGTAGCTTACACACACACCATTACCTTGTAGATTTCTGGATCAAGCGACGGGAGATCGTTCAAGTGGTTGAACGAGTGCAACAGCTTTGACAGGAAGAAA
TGTGCAAACTTGGGCTCAACGACGATGCCTTCGTACAGCGCTTTGCCGAGAATCCGACCCACAAACTGGAACAGCGTCAAGTGATCGCTCTCACGAGAGA
AATGATTGGAAGCTGAGAACGGATTCGGGTACAGCAACTGGTCGCTTGTCGTGAGGAAGAGACCGTACTGGAGATCGAAGGCGAGGTTTGAGAGATCGAG
CCAGAACTCCTTGAACAAACCACCGGCATCAATGCCCACTTCTTCGCGTCCAGCAGCGTTTACAAACACGACGTTGATGCGCTTTTTCAGATTCGACTGA
ATCACGTTGAGCTTTGTGAGTCCGTCCTCGAGAATCATACCACGACGGATGCGAATGCGATAGACAGAGCTGCCGTCCCCTTGATGGACTTCCTTGTCCA
CTTTGATAATGCGCTGGAAGAGCTTGACTCGATCTGGGAATGGCACGAGGTACGGCATCGAGGCTATGAGTTTGTTGGCACGTGGAGTACCGAGGATCAC
CTCTTCGATGAGCTGGTTGCTGTCCAGCTCTTGCATACTCCTAAAAGCACGGAATCGGAACAAGTAGGTAGAAAGCAACAAAGAAGCGTAAGAGAACAGA
ACTACTACAAATCAAGGCCAATGAATAGCAGCGTACCAGCTCGTGACGTTGCAGAATGGTCGTCGAGAGCAGCGGTTATACAGATCGCGCATCAACGCCG
TTGCGCCATCAATGACAAACATCCCAAAGTCAAAGCCCCATGGATCCAACTTTGTCAGAGCATCCGACACATCCCCGTGCGCCCAATACGCTGCATGCAG
AGCGTGCTTTAACGAAAGCACGAGTCGCTCGACTTGGAACAAAGGCAGTGGATACTCTTCCTCATACATCTGCAAGTAAAATGCAAACAAGATGATATCA
GCGATGCAAATGACTCGTTCATGAGACTGCAACCAACCTCTTCGTCATCCATCACGGCAAGCAGGTGATTGTACGTCATACAGAAGAGCGCGAGTGTGCA
CACATAAGCGTCGGAGCATTTGGCGCGCACCAAATCAACATCCTGCACAAAAACAACACCCAGCATTAGCCATACACTAAATGATGGACGATAACAACTT
GAGTACCTTCGCGAATTCCTCAAAGTTTCGAGTCTCTTGGAGCACACACCACAGGAAATGAACTAGCGACAACATTGTTTGTCCTTGTTCACTGCCGTCA
TTGTTTGTTGCGCACTGGTAAAACGCGAGTGTATTCAGCACTTTCATACCGTGAGGCTGAATCTTATTGTGCTGACGTCCCCAGCGGAAGAGGAACGTTG
CCCAGAGTAGCGAAAACGCCTTGACATTCTCCAGCGCAAATGGTTCACCACCGAGCGCCACCTTCTCCAGCGAGTTCGCAACCAACGTAGCGGAAGGTTT
CGAGTCAAACGTGGCACCAGACGCTGCCAGTTTGCGCGCTGATGCTGAGGTGTTTGTTAGACTCAAACGTTTGGCATTGCTGGAATCGTCAAACTCGTTG
TGATGTTTGCGACGAAGCCCTGCTTTCTCGAGCAGATTGCGAGCCCAGCTTGCCTTTCCGATCGACTTCATCTTCTTCCACGTCGCTGAAAATGAGCCTG
CAAACGACGATTCCGATGCAATATCGCCAAAACCGTATTGCTCCTATGAGTGTAAAGAAACGACAAAATCATAGCAACTCGATCGTTTGCGGAACCGATT
TCAACGTGACCCATTTTTATAAAAACATACCGCAAGCGTTGGAGCTGTCGGATACATTGGAGTGGGGCGAACAGACGACAGCGGGTGACGAAGGCACTCC
GAGTTGAACCATATCAGGTTGTTGCAAATGGTTCGCACGTATCGGTCTCGCAGCAAAATCTGGAGCTGATCATTCAGGGCTTCGGGGTACACGACAGGCA
CCGAGTGGGACTCGGATACTTTTGTCCACGACACAGCGACGCCATTGGCTGCGTATGTTTCTGGTGGCACTGTCTGAAGCAACTTTGTCAGCAACTGCGC
TTCGTTTCGGACAAGCAGAGGGGTCTTGCCTTCAACTCTGCATGTTATTGGAAAAAGAAGCAAGCATTAAATAGGTAAACCGATGACAAAGAAATAAGCA
TTCAAGAAGTATGGGGATAACTGCACAACTCACCTTTCCGAAATCCATAGCAAGTTTCCAAGTAGCCAGGTTGACGATGGGATCCCCACGATGGGGGGAT
CCGGAAGATCCACAAACGGCAACGGCGCAGCAATCGCAACGACGCGTTCCCACAGGCGTGGCTCTGCAAGCTGAAGTAACCGGTCCAGTGCCACAACTTC
GTGCAGCAAAGGCACTGAAAGCACCTACATCCATAGCACCATA