Description :
From Genome Similarity Track
Location :
Scaffold_249:8350- 11418
Transcript NameFunction/comments
Phyta_totarag6169ABC transporter ABCA1 lipid exporter family

Sequence
3068 bases(100 bases per row)
GGCGGTACGAAGGTCGCAGTAAAGGGTCTGGATTTGGTCATGTACAAGGATCAGATCACGTGTCTACTTGGCCACAACGGTGCCGGTAAGTCCACGCTGA
TCTCGATGCTCACGGGCATGGCAGCGCCATCGAGCGGTGACGCTACGTATCGCGGACTCTCATTGAACCAAGACATGGAGGAAAGTCGTGAATCACTGGG
AATCTGCTTCCAACATGACGTACTCTTCGAAGACTTAACAGTCGAGGAGCATATCATGCTGTTCGGACAGGTTAAAGGGTACCGAGACGACGAGCTCCAG
GGGCTAGTGGACTCACAGATTCGCCAGGTGGGCCTAACTGAAAAACGTCACGTCCTCTCGAAGGAATTATCGGGCGGCATGAAGCGCAAACTCTCGGTGG
CGATTTCTCTACTTGGTGACAGCTCGTTGGTGTTCCTGGATGAGCCCACCTCCGGCATGGATCCCTACAGCCGTCGCAGCACCTGCAAAACAACCGCAAC
GACCGCGTCATGGTGCTGACAACACACTTCATGGATGAAGCCGATATCTTGGGAGACCGCATTGCCATCATGTCGAAGGGTGAACTGCGCTGCTGTGGGT
CTTCGCTCTTCTTGAAGAACCGCTACGGCGCCGGATACAACCTCACTCTTGTGAAAGACGATGCCAAATGCGACGACAAGGCTATCACCAACCTCATCAG
GTCGTATGTCCCATCTGCagagctgctgagcaacgTTGGCAGCGAAATCGCCTTCCAGCTTCCTCCGAAAAGTTCACCACTGTTTGCTCCCATGTTCACT
GAGATGGACAACAAGATGGCAAAGTTTGGTTTGATTTCTTACGGCATTTCCGCTACCACGTTGGAAGAGGTGTTCATCAAAGTGGCAGaggcggacgacg
agaaccaCCAGTACACACTGGGTCACCGGGCTCGTCCGGAGGGTGATCAACCGGATTCTGGGGCCGTGTACTGGCGGGACTATTGATTTTGAAGAGCAGC
GGCACCACGTCTGATGATCCGACCTTGGCCTTGAACACGAATGCGTATAGCTCCGACAACTCCACTCCGACCCCATACTTCTGCCAAGCCGATGATGCAT
GGTGCAGTGATGCCATGGCGTCCTACTTCTCTGGTGCGGCCGCTCAAGAACTCGCGATTGATTCCCCGGCTTACGACTCGAGCTCACCGACAGTCTTTGA
CGTGACCTACTCAGACCCGAAGATCAACGCAACCGATTCTACTGGGTATGAGCTTCGAATGGGCCAAGAGTTGTACAATAGGGGCTACGGAGACAACAAC
ACCGAGGTGGTTGACGGCCAATACGGCGCTTACTCATTGtacagcgacagcagcgagcaaATTTTCGGCTACAACTTGTTCGTCAACACGACTGCGACAC
ACGCGCCTGTGATCTTCAAGGTGCTGATGGACCAAGCGATCTATCGATTCTTTGCTGCCAACACCAGCGATTCGGCATCATCCAGCGTGGATCTCATGGT
GAACAACCACCCACTGCCTTTGACAGCGGCGGCCAAGGCACTCTTCGGCTCATTCCTGGCGTTCAGTGCCTGCGTCTTCGTGTGCATCTCGTTCTCTTAT
TTCCCGTTGCCAGTCGTGATCTACTTGGTGAGGGAGAAGGAGGCGAATCACAACTCCAAGCACCAGCAATTGGTCTCGGGCGTCTCGCTGATTGCCTTTT
GGCTCGCCAACTACCTCTGGGATCTCATGATGTATGTCGTCGCGTGTGTCGCGGCCATTGTCCTCATCAAGATATTTGATGTTTCGGCTCTGACTGGTAA
CGCCGAGTGCACCAGTTGTACGTCCGAGATGTTCCCGGCGGTGATCGTGCTCTTCGTGCTCTTCGGCTTCTCGATTTGCCCGTTCACGTACTGCCTCTCA
TTCATGTTCAAGGAACACGCGGCGTCCCAAACGTTCACGATGAAGATCAATTTCCTCTTGGGAGTCGTGCTCATGATTGTATCGTACATCCTGGATGTGA
TCGAGTCAATGAAATCTGTGAATTCGGTTCTCAAGCTCATCTGGAGATTATCGCCGCTGTTTGATCTAGGCAACGGACTTCTCTCACTGGTTCTCAATGA
ACTTGACACGCTGCAGGACGGCTCGACTGAGAAGAAGAGCCCATTCAGCACTGATCTCATGGGTGCGGAGTTGATCTATCTCGTCCTCACGATGTTCCTC
TTCTCGACTCTGGTGCTGGCAATCGACTATGACGTGAAAATTCCAGGCCTAGTGCAAGCGCGGACAGCATCGAAGATGGAAAAATTGTTATCGACGCGGA
TGTTGCGAAGGAAGCCCAGCGAGTTGCTAGCGGTGAAGCAAATGGTGATGCAGTTAAGATCGCTGGACTGCGGAAGGTGTACCCTGGTGGCAAGGTAGCG
GTTCGGGGCCTTTCGTTCGGTTTGAAGCGCGGCGAGTGCTTCGGCTTCATGGGGATCAACGGCGCTGGTAAAACTACGaccatgaagatgctgaccGGCG
ACGTCGTGCCGACTTGTGGAACCGCCACACTCGGTGGCTTCGACATcttgacgcagcagatcgaaGTACGCCGCCAGATTGGCTACTGCCCACAGTTTGA
CGCTTTGTTTGAGCAGATGAGTGTGCGCGAGCATCTCGAGTTGTTCGCTGCGATCAAGGGCGTGACACGAGCTGACATGGACGCTGTTGTGACGGAGAAG
ATTCAGCAGATGAACCTCGCGGACTTTGAACACAAGCTGGCTGGGAGTCTGAGCGGTGGCAACAAGCGCAAATTGTCGGTGGCCATAGCGCTAATTGGCA
GTCCGCCGATCATTTTCTTGGATGAACCATCCACTGGCATGGACCCAGTGTCACGCCGCTTTATGTGGGACGTCATCGCCGATATCTCCACTCGAGGCAA
GGAATCCACGGTCGTGCTGACAACGCACAGCATGGAGGAATGTGAAGCGCTATGCTCTCGAGTGGGTATCATGGTGGGCGGTCGCTTTCGGTGCTACGGA
AGTGTACAGCATCTGAAGTCTCGGTTCGGCGATGGCCTCGTGTTCGACACCAAGCTTGATGCTGTGAC