Description :
From Genome Similarity Track
Location :
Scaffold_1185:835- 4938
Sequence
4103 bases(100 bases per row)
TGACCAACTCACATCAGCGATCCTTCTCCTCCCGACCCACTCCCTTCCTGTGGGTGTTTCTTCATCCTCCCATCGACATGACCAACTCACACCCATGGAT
CCCCCCCCCTACTCTTCTTCACGAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGAT
CTGCTTCGTCTACCCAACTGGGTACGTCATATCCCCGCCAATACACCAGAAATTAACGGTAGATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATC
GGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCAGGTAGGAGGACTTCGTCAAAATCCACCCGGTCGGATTCATCC
ACCGAAAGACGGGTTTGCGGCCGATCCGGATATTCCTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCGTTT
CCAACTTCACCGCATGTTCCCCTATTTTTTCGCTCACCCGGAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCATACCCTTCCTTCACCCGATTTAA
ATAAAGCCGCACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTC
ACTTGGGATCTGGCTTGCCGATATATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTC
CAGGGTGGGTTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCG
TACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGAC
GATATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTCTCGATCATGTCTAATCATCTC
ACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGTTCGGCAATGGTTTATGCAGTTCTAGACGCACTAGCTTTAGCTACCACGTATCCGGTAAACA
GATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGAC
ATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACTCAATCACCGATATATCGTTGAACGCTCTTGAATAGTCCCCTC
CAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATCCCCTGATGTCCTCCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGG
TTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTCGACTCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATC
CGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGCACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTTGTTC
TGTGCTTTGAGGATCCGCTCAATGTGGACTCCCTTAACAAATGTTTCATCGAGGATCTGGGGGCTGGATCCAATCCTTCTTCTGGACCCAGTGACAGCCA
TTATCTGGACTGTCTTTTTCCCGGATCCAACCACCACCACCTCATTTAGTCGGTTCAACATAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCGAC
ACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGG
TGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCGGGCCTTGCCGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCACC
AGCCTTTTTGGATCCTGTTCCTTTAATAGATCCAAACCCAGCAGGAGCCCGTTATACTACGCTTCACTGACGGTGAGGCCCTCTGCATAAGTGGATCTGG
CCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAATTAAGGACGTACAG
ATCCTCATCCACTTGTACCGTCGGGATCGGGGTTTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGA
GGTGTGATGCTCGCGGCCAAGACTCCCAGTATCTCGTCTTCCCCTTTCAAACATTTCACGATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTC
CCAAACGTCCTTGTAGCCCGGCCGACTTGAACAGCCAAGCTAACGTAGAGTGTCGAGTCAGGATTCGGATGGATCTTCCCACCAGCAGGCTGTAATTGAG
ATCCAACACGCGCAGGAGCGCGAGTATCTCCTTCCCCACCGCTTTGTAGTTCAGTTCATTTGGCTTTAGCGTCCGGCTGACGAAGGGGACTAGATGACAG
ATCGCTTCATGTTCTTGTACCAAGACTGCTGAGACTGCCCAATCACGGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATGG
GCGTAGTCGCGATCCTGTTCCTTAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGATGTTCCACCCTTTCCGAGTTCTGATCCGTCGTCTCTATCCC
GATTGGATCCTCTTTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTAAATCCGACATC
TCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCCCTCAATTCATATAGTACCGCAGCAAACAGTG
CGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAGGAACAAGTCTGCCAACGAAGACAA
GTCCTTAGGATTCACCCCCAGTCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCGCTTTACTACGCTGATAGAGAGA
TTCCACTTAGTACACGTCTCCAGTAGGGATGCCACTCTCTCGCACAACAGGTCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATATGATCTGCGTC
CTAACACAGACGGGGTCCCAGGATCCCCTGACTCTCCTGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCTCCCTTTTCGGGTTCCGGTAT
TCGGGTGAATCCGTAGAGGGAGTTATCGATCAGGCGTTGGTAGATCTGGGGCGCGTTCTTCAATCCCACCGGCATCCGGTTCCACTCGAACAGTCCAAAC
GGTGTGATGAATGCGGAAATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGGCATGTCCAGAGAACGGAACCATAGTACTTTATCCA
AATCCTCCAATAGCTCATTGATTAGAGGCATTGGATACACCATCAATCGGGTCAGGCCGTTAACTAGCCAGTAATCAATGCACAGACGTATATCCACACC
GTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTGATCAGATCCGATAATTTT
TCTCGGAACTGAGGTGCCACTTTCCGCACCCTTTGAGCGATCGGTTTCACGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAATG
CATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAACCGATCCACTTCCGCGGGTTCGTTCGCCCCTGGATCCACTTGGATATC
GTT