Description :
From Genome Similarity Track
Location :
Scaffold_1733:835- 2937
Sequence
2102 bases(100 bases per row)
TTCACTCCCTCCTCCAAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCT
TCCTGCGGGCACTTCTTCATCCTCTCATTGACATGACCAACTCATATCCATGGATCCCCTCCCTACTCTTCATGAGACTGCATCACGCCGAATCTGTTAC
GAGTCGTGCGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTACCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATGCACCAG
AAATTCACGGTAAATCCGTCCGTATCTAGTCCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGTTTCGAGATCCACATTCCAA
CTATCTTCGGGTAAGAGGACTTCGTCGAAGTCGACGCGGTCGGATACATCCACTGAAAGACGGATCTGCGGCCGACCCGGATATTCTTTGACCAGCTTCA
ACTTGGATACGTGTACCACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCC
ATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCACACTTGGATTTTATGTGGACGGGCATCT
TCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCCGTTCGTTCACCTGGAATCTAGCTTGCCGGTAGTATTTCTGGACATGGTATCGCCAT
CGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCTGCTTCCAGGGTGGATTTGGGATCCCACCCAGGTACCAGGTAAAATGGGGTAT
CACCCCGGATCCTGTCTTGGGCGGTGATTATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACCTACATCTTGAG
TGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGGCGGTATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCTGGTTGAAT
GCTCGAAAAAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTGGCTCCAAATCTTCGGAAAACACACTTCTCGTACGATTCAGCAA
TGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTATTTCCCTTTGAACGACTTGG
GCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTACCCTTGCCTGT
CTCACAATCCACTCATTCACCGACATATCGTTGCACGCTCTTGAATAGTCCCCTCCAGTTGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCC
TGATGTCCCCCTTCTAAACTAGCGTGGTAGTGGTGTAGGACATCCTGTTGTAAGGTTTCTGGCATCACCAATCTCATCTATCCATCCCGATCCTCGTGGA
CCCTCTTCGTAGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCCGACTCAAGT
CTCGTACATCCCCCATCAGATACTTCTTCAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCATGCGGACTCCCTTCACGAATGTT
TCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACCACTACCACTTCGT
CAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCAGTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAACTATCCGCACT
GGCATTTTAATCTCGCTTGACATGTACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTG
CA