Description :
From Genome Similarity Track
Location :
Scaffold_2825:835- 2590
Sequence
1755 bases(100 bases per row)
GTCACCAGATCACGAACTGCTACATGTTAAACGTGACTGGAATGGTAGCGCGGACAGCCTGGCGAGCGCAGCTCTCCAACGTCAGAGAGGACGCGACATT
GAGAGTGAAGCGGATCGCCAAGACCTGATCACGTTGAATCGACTCGATGAAATTCTGCTAGTCGGATCCAATGATCCAGTCGTCCAGATCTCGCCCTTGG
CTACTCGGTCCGGTGCTCTATCCAGAACAAACCCTACGGTCATGCAAGAAGAGTTTGTCCGCGGGCTGCGGATCGATCGGATCCGAAAGGCACAGGATGA
GGAGCGTGGATCTCAAGTATGAAGAAGTACTTGGCAGGAGATGTGGTGAATCTGACGCAAGACGAAGTTAGATCTCTCGGCAATATTGCGGCAGACTATG
AAGTGGATAGCCAGGATCTGTTGCTCTACTGCCCGCCTACCAAGAGATCTGAAGCCGGTCGCGACGGATTGATGAGGCTGGTTGCACCAGAGACACTACA
CTAAGACATCCTGCACCATTACCACACCAGTCTGGAAGGGGGTCATCAAGGGATCGGGCGTACCTATCAGCGGATCCGGGATCAGTTTCACTGGAGGGGT
CTATATCAGAGCGTGCAGGAGTATGTCGGCGGATGTGTTGACTGTGAAACTGGCAAGAGACGGCCAACGATCAGGGGCGAATGGCCTGGAAACATCCAAG
CTACGTACCTGTTCCAGATCATCGCGATGGATCACATACCGTCGCTACCCAAGTCGTACAAAGAcaacacggagctgctgattTGGGTCGATCTGTTCAC
GGGGTACGTGATCGCCAAAGCTAGTGCGTCTTGGACAGCGCAAACGATCGCTGAATTCTATGAAGCGTGTGTCTTCCGGAGATTTGGAGCAAGTGAGACA
ATTAGACACGATCGGGAATCCTGATTCATGTCGGACTTCTTCCGGGCGTTTAACAAGATCATCAGGCAGCGTCAGCGAGCCACAATGGCCTACCGACCTC
AGGCTAAAGGCACGGCAGAACAAATGGtacagacgacgacgagagcttTGAAGATGTTAGTTCAGGATCTAGATCAACGGGATTGGGATGAGTATGCTGA
ACGACTAACGTTCGCGATCAACACAGGTCAAGATCGGGTTGGTGGAGATACATTCTTCTATCTGGTACATGGATGGGATCCGCGATCTACACTCGAGGCG
ACTATACCACTGGGATGCACCCGAACGCAGGATGGCGATCCCCGGAGGTGGTGATATCGGATCCAACGACACTTCACGCAGACACGAGAACAGGTTAATA
ACCGACTGCGAGACGCGATCTCGGATCGAGCCCATCGGCACAACGAGGAGTTCGACCGCACTCGATCGGAGCTGTGGCTATATCTGGATCGAGTGAAGGA
AGGCTACGCCCGGAAGCTAACCCATCTGTGGCATAGCCCTTTTCACGTTGCGGAAAAGATCAACGAGTACACCGTGCGTCTACAAACCGATGGGACCAAA
TATCGTCTATTCCCGGTTGTACACGTGTCGAAGTTAAAGCTGGTTAGGGAATTCCCGGATCGGCTGCAGATCGAGTTGACCGTGGACGAAGCCGATCGGT
TAGATTTCGACGAAACTTTGCTTCCCGAAGATAGCTGAGTCCCAGATCTGGGTGCGAATGaatacgaagtggagaagaccCCCGACATGAGGACTGGTAG
GAGGACGCGGTACGGCCGAGCCTATCGAGAGTTTGTGGTGTACCGAGATCCGTCA