Description :
From Genome Similarity Track
Location :
Scaffold_35:83480- 84967
Transcript NameFunction/comments
Phyra_78835Amino Acid/Auxin Permease (AAAP) Family

Sequence
1487 bases(100 bases per row)
TTGACCAACTCTATCTACGATTCGTGCACGGCCGTGTAGTTGTAGTACACCGTGTTCTCGAATTCCGAGTCGCAGTACGGGAACTCGACGTCCGAGTCCG
TGGGCGAGAACAGCGTCTTGCCAGACGTGTACGTCACGTAGCAGCCCAGCACGCAGCACACGACCACGACGGCGAGCGCGGGGACCTTCTCCCACATGGG
GATCGTGCTCCAGCACTTCTTGAGCAGGAACACGATGGGCAGGATAATGCTGTTGAGCGAGATGCACGAGGCGCCCACAAAGTCCGACAGGTCCGAGAAG
TGGTCCTTGAGCACGATGGACAGGATGACGAGCACCACGATGATGGCCATGCGCATGAGCACGTACTTGATGGCGTTGGCGCCGCGGTACTCGGCAGCCT
CGGCGTCCTCGTCGCCGTAGTGCGGGTTCTCAGCGTCCGCCACGGACACGTACGAGACCTTGGAGCGGCGCTCCGACACGTTCACGGACTCCTTGGCGGG
CGTGGAGGCATCGGCGTACGAGATGGCGTTCTCGATGTCGCCCTCTTTCTTCTTGTGCATCCCGAGAACCAGGCGCTCGGCCAGGTAGAAGGGCGGGTTG
AGCAGCACGGAGAAGGCGATGGTCACGTGCAGCTGCATGAAGAGGTAGGCCAGGACAACGGCACCCCAGTCCGACTTGAAGCCGAGTGTCGTGAGTCCCG
AGACGGCGTTCGGGTAGATAGAGAAGAGCAGGTTGCCCGTGATCTGGCAGCCCACGGCTGAGTACGCCGTGCTGGCCAACACGAGGAAGAGCACCGAGAT
GAGCGTGATCGTGAAGAAGACGACGCGCGGCATGCGCTTGGGCTCGCTGTGCTGGCGCTGCAGCGCGGGGATGACCACGCCGGCACCGTAGGCCAACGAC
AGGTTGCCGAAGACACCGGCCACCTGCTCGAAGCTGAGCTCAGGCGCCGGCACGGACGGGTGGCCACGCATGCCGTACATGACGACGGCGACGCCGATGA
CGTCTGCGATGATCGTACCGAGGCAGCCGGCGAAGGCGGCTCCCGCTCCTTCCTTGAGAGTCGGGATGAGGCACACGGGCAGACACATGAGCGCCATCAA
GATGATCCACACGGACTGGCTGAAGGCGTCCGGGAAGAGGCCGTCGAGCAGCGAACCTCCCAGCACGAGGAAGACGCAGGGCACGAGCAGACACGAGGCC
ATCTGCGAGATGACGGCGAGCCAGTGGCCCCACTTGCCCATGGCCCAGGCGCCCAGGTCTCCGTACGTGCGCACGGACTTGGGCGCGAGCAGCATGACGC
GGCAGATGGCGACGGACGCGTAGATGTTGGCGAAGGCCATGAAGGCCATGGCGATGACGGCCAGGACGGGGCCAGCACGCGAGAAGTTGCCGGGCATACC
AAGTGTACCAACGCCGTAGACGCAGCAGAAGACGTTGAAGGCCATCTTGAAGTCCTCCATCGTCATGAACTTCCCGCTTCCCATGGT