Description :
From Genome Similarity Track
Location :
Scaffold_93:83465- 88681
Transcript NameFunction/comments
Physo_141028hypothetical protein

Sequence
5216 bases(100 bases per row)
GAAGAAGAAGAGAGAGATACAAAAGAGAAGAGAGATAGCCAAAGAGAGAGAGAGAAGAGGATAAAGATCAACAGAGTTTGTTTTGCGTTCAAGTGCACAA
GTGCTTGGTTCGTAATTCGCCTAAGGACAGCCGCCGCCCACGGGAGAGTGTACCGCCTAGGAGCCCACGAGAGGGTGTACCATTCGGAGCCCCGCTGCGA
GCGTTGAGTAATGCCTAGTCCAAGGCCCCCGAAAACTTCTCACTACATCAAGCCAAGTCAGGTACCCAAACGTATTGCCCAATCGGGTTGGTACACCTGT
TTCATTTCCCAGTTGTGGCGTACACTCTCAGTGTGCGCTTGCATTTCATATTCCCTGTGTTTTAGGAGGTTGTGGCAATCGCCCCCTAGGACCCGATTGT
AGATTGCGTGTAGTAGGAAGGTACCTGTATTGTTCTCCTGACATTCAGGAGTGGTGCGCGTGGGGCATCCCGAATTTACCTGTATTCGGGGTGCAACCTA
AATTGACAGGCTGCATATTGTGTGTACAGACTCTGTATTGATATTGGTTATTTTGGAGAAGGTCTTTGCTCGTGATCTCACTCCCATTCAGGACTCCCGG
AACGAGTAGCGCCCGGAAGTTCTCTGTATTCCTGTATCTTTGATCAATTGCGATTCCCAAGGTTGAAACTCGGTCCGCCGAAGATAAACGACACCTATAG
GGATTGCACAAGGTCACACGTCAACCGGAGCTTATATTCATTGTAAGTTTCGGGTTTCCGTGAGCTAAACCCTCCCGGGTCTAAGCCTACCGGACGTACG
CTATACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCTCAGCTGGTGCGCGTGCCCGGGTTTGGTTGCCTAGGGTTTTGACCGAGAATTGTATATTG
ATTGAGTATCTTTGAGGGGTGCTGAGGGCTACTATCCTACAAACTCTTGGGGTTATGGCTGGAAGTGAAAGCATACGCGAAAGGGGACGCGGCGGACGCA
CGGATGGCGTGCGACGCTCGCGTCGGACTCAAGGGATGCCGCCGGAAGAGCAGCTCTCGCTCGAGGAAGTCGAGCGGAATGCTCGCCGGACAAACGCCGC
GAGGCGCAAGGCAGCTCGCGAGGAGAAGGAGTCGACGGAGGCCCAAGATCAGCCGGAATCGGAGCCGGCGGCCCAGGATGCGCATCACGTGTCCCTGGAT
GCTGTCACCCCGAATGACGAGGAGAAGGGGCCCCCGAGTGGCTCGGAAGTGAACTCCACCCCGGGGTCGGAGGTGGAGGTTGTGGGTGTGTCCATTCCGG
ATGTGTCCACCCAGGCGTCTGTGGGAGGCGCCGTCAAGGTTGAGTCGTCGGCTGTGGATAGACCTTCGGGAACTTCCCGGCCGGCCCAAGATGTGATCGT
GCTGGACGTTGACTCGGATGAGTCCCCCTCGCAGGCGCGCACGATCAAGGGAGAAGGACCGTTACCAGCCGTCCAGGAAGAGCCGGCGTCAAGCCTGCCG
AACGAGACTCCGTTACCAAGCTCGCCCGTTCCGAACGCCGCTCCGGATGCGCCGCCCAGGGTGGCCACCTCGGAGGACCCCCAAAATGGTCATCGACCTG
ACTGGTCCTGACGAAGATTCCGGAGAGCAGGCGTCCGCCGCCCGGATGAAGGAGTTCGTGGCCGACCAGGTCCACAGTTGGGAAAGGGTGACGCTCGAGT
TCGTGATGTCCCCGACTGTTGAGTACACATGGCCCAGCCCGACACCCGACTTTCAAGCGTGGTGGACGGCAGCCATGGCGACGTCCCGATACGTTGCGGC
TCGTTCGACGATGGGCTCGCTCGTTCGACGATGATGCACCCGAGCGACAACTGGATTTCGAATTGGAGCTTGGTCCGACTGTCTCCGTGCACTGCCGCGG
ACGCCACTGCGGCCATGATTCCCATGATCACGCTGTCACTGCGCGAGTGCGCCGCACTGCTGCAGACGCTATTCTTCGAGGCGGGATTGAGGTTTCGCAA
TCTGATTCCCCAGTGGTTTCAAGCACGGGCTCCCCGGGTGGAGCCGATCATGGTGCGGATGCTCATGCAGGAGCTCCAGCAACAACTGGCTGACGAACAT
TCGGAATGGCGAAGCGTCGCTGCGGGCGTCCCAAATCGAGTCATGCCAGCGCTGGACGTTCATGTGGGGGATGCTGCCCTGGATGCGGTCAAGGAGGAAC
ACCCGGACGACGACGTGCCAATGTCGACCCGGGAAATGGACGTGCTCGGTCGAGAATGTCTTTTCCGGATGAGGGTGGCTGGAGTCCGGCCGACCCGAAG
TCCGGCGAGTTCAGCTGTGGGCCGCCCTGAATCCAAGCGTCCGCAATATGGCCCGCCACGTCCGTCGTCAATCCCGTCCATGAGCTCCCACTTGTCCTAC
CGGTCTTCCATCCCGGCGAGTCAAGATGCGGACGCTCTGAGCGCGCGGATGTCTGTCACCCAGAGTGCAGTTTCCCGACGAAGTTCAGGACGAGAGTCAA
GTCTGTTTGGGACGACGGCCGCGGATTCGGAGGAGTCGAACCCCAGCGCCACGTCCGGGTCGCGCTCGACGGAGCCATATTCGTCGTCGGGATCCTCGCT
GTGGTCGCTTGGCGGAGCCACCGGCGCTCACATGCCGTATGCCGCTCCATCCGGAATGGTCATGACCGCCCGAAGTGGCTCAGCCCCCATTCAGGGAGGC
TGGGGCGTGCAAGTCGCGGAGACGGTGCTCCCTACACCACCAGTGCCGGTGAACCAGGACGATGTCGATATGTCGGAGTCGGGTCACACCAGCATTCGGA
GTGGTCACAGATCGAGGACGTCCCGGAGGCACACGCGCTCCCGAAGGTCAAGCCCAAGCAGCTCTTCCGGCAAATCCAGCTCGGAGGACGAAAGGCGCCG
TGGCCGCCGAGGATCCAAGCACCCTCGCCGTCCCAAGCGGTCGCCCAGTCGATCCGTGAAGTCCGGATGGTCAGTTCACTCCTCTGCGTCGAGAACCTCC
AAGATAGCGCTGACCATGATGCGAGTCACGCAGGATGCCATGATTCGGGTGGATGCGAGTGTTCAGGAGATGAAGCAACAGCTCCAGGATAAGGACAACG
CCTCGGACCGGAAGCCCGAAGCCGCTGACGAGGGGAAGCGAACCTTCCAGACCTACCAGGCCACTCAGCTGCTGGTCGACCGGGAGGATGCCCTGGAAAA
CCAATGTGCCCTCGACACACAGGCCCCAGTTCAGGTGATCATAAGTGAGGCGACGACGGAGAAGGCCCGCGAAGTCGTGGGAGCTATCCAGGAAGATGCC
TTGAAGCGTGCGCGAGAAGCCGTGAAGGCGGAGCGCGCGCAGGAAGAGCATCTCCGGTCCGAAGCTGAAGCCGCGAAGCTGCAAGCTCAGGAGGCCACGA
TGCAGAAGACACTGGAAGAGCAGCGGAGATTACTGGAAGAACAGCAGAAGCTCTTCGACCGAAGGATCGCTTTGCTAGAAGCAGCCTAGTCGAGGGACAA
GGCGGCTGGCCCTGACCAGGGGAATGTTTGGAGAACGCGTTCGCGCGACACTCGGACGACATCATCCCATGTTCAAGGAGCTCAAGCGACACCCGCACCT
GATCCGACTGTTCAGGACAAGCAAGAGACGGGGCGCCTGACTAAGCACCCAGAATCCAGTGGCGTCATCACTGGATACGCAAGTGATAGACGGGCCAAAC
CAGATGGCGACCTTCCAGCCGCCCACCTTTAAGCAACGCTGGCGCCGATGACTGGTGTTAAGTATGAGAAGGAAGAGTCGACGCCCAGGGTTGTTCCATC
GAAAGCAACCCAAGCGACGACCGAGAAAGCGGGATCCAAGCCGGCTGCCTCCTCTCGTTCGGAGACCAAGAAAACGGCCACCCGGAATGACTCACTCAAG
AAGCAATCGAATAAACGTGGAGACCCCTCGGACGACAGCTCAAGCTCGGACTCGAGCGAGGAGGACTCAAGCGATGAAGACTCCGACAGCTCGTCCGGTG
AGGTGACCACCAACGTGGCGACGGCGATGACCCAAGGCGGGACGACGATCATGTCGTTCAGGCCGTATGTGAGCTCCAGCGCTCTGGAAGACTTCAACGA
GGACGCTCCGTTAGCCGTCCGGCGCCTATGGTGGGAGAAGTTCCAGAACCTCGCGACGCAAGGCGGATGGTCCGACAGGATGCGAGTCTGCGAGCTCAAG
CTGAAGATGTCGCCGGAGGTCCGGAATTGGAGAGGCCAGCTCTCTCGGCACGACCGCCAGGACTGGACCAGGTTGTCCAAGGCCTTCCGCCGCGAGTACT
GCAAGTCCAAGGTGTCTTAAACCGAGCGCTACTACACGATGACGCAGCGCAAGGGGGAGAAGGCACTGGCGTTCCTGTACCGCCTGAACATCGCGGTGGA
GCACGCGAAGGTGGTCCACAGTGGCATGTAGAATACATCTGGAGTTGGAACGAGCTTCTTAAATTCTCCAATGCAGTCTCGTCGCGGTGTACTTGCGAGA
AGTACTGAGCAGTCCTCTATCGGTAATTCCGTCATAGCGGTTGGATCGACCGAGTCCACGAGGCACCACAGGTCAGGCGACCAAAATCGTTGGTCAAACT
TATTTGGCAGTAACATCGTCGACCCATCAAAGTAAATCGGTCCCTTCTTGGAGAAAAACAGCACGCGTTTCTTCTCCTTGATCAACCTCCACATCATGTA
GTAGACGAACACCGACTTGCCTATCCCAGGCGTGCCCGTGACGACAGCATACTTGACCATGGTCCGATCTGGATTCATCAGTGCTTGGTCGGCGATCACT
TTGTACGAAGAACGAATGTAGAGCTTCTGACGTTTTGCTAACGGCAGCAACGACGAAAATTCGAGCCAATCGCCTACTTGCTCAACCGCGGGGAATTGTG
CGAAGAACGGATCACTGCAGGGATCAAAGACACCATCTTGGGAGACAATTGAAGCCGAGATCGCTTGCTTTGGCTTTGGAACAACCACCAGCACGTGCAC
CACGTTCTTTCCAAGCGAAGCGCCAGTCCCAAACAGATCCTCCAAATTCCGCGACGCGCGCAACTTCTCCATCTTCGAGGTGTCCACATTGTTCTGCAGC
ATCCTGTCCAGGTCATCGTCGTCTGGGAGCCATCCGCCGTCTGCCTTCTTCGCCAAGAAGAGCTGCAGCTTGTCTGCGTCGATGTCCTTGAGGTCGTTCG
TCTTCTCCTTCTTGAT