Description :
From Genome Similarity Track
Location :
contig_32:83464- 84904
Transcript NameFunction/comments
g7267.t1hypothetical protein

Sequence
1440 bases(100 bases per row)
GCGAGCTTCGTCATCTTCTCTTTCGACATTGACGGGCATATTCGAGCGTTGTCGGATTGTTCACCAGACCGGAATTACATGCATAGGGAGAATACAACGC
GTGACGTCAAATCTCCACTTTGCAAAACTTTGAGACGTGCATTACGACTGGAAACAAGTTGCATGCACGGGACGCCGCAGAAGCGAAAGATTCCATTTCG
GATGTGCATTCTGCTGAAGCGTCTCGCTGCTTGCATGCAGCTACAGTATTCTAGCTTGCTGCTAAACGCAGCCCACGAAGCTCAACCGAGGCACTCGTAG
TTCCACGTATCGTAGGGGGGCGCGCTCACTACACCAATGACGAACTGTATCATCCTGACCCAAGCTCAAGCTCCAAGGTGGAAGCCCTCGCCGTATAATC
AAGACGCTTAGGTATTGAGCTTTGTCACGAAACATCCAAGCTACTGCCTATACACTGTACATGTGACCACGCACCACCAAAGTAAGACATTGGTTTGATC
TTCATCTCTCTCCTCTTCAACCCTGTATGTAACGAAGACGCGCACATCCGCATGAATATTGCACTCCATGGCAACAACTTGTTGCCCCATCAGATTGCTG
CTTGACACGGGAAAAACATGCAAGCGGGTGACGCGCGAGTTACGTTGTGCATGGAAGATATTGAAGTTGAGATGTGTTTGCTGTTCGAACGCACTGGAGC
GACGACGCAGACTGGCAGAGTTCCTTGCCCTTGCGCAAAGCTCATTCTGCAACTTACCGCGCCATACTCACAGCACTCGTGACTCCACCAGCCCATTGGA
AACCGTTTCCACTACCAATTTCCCAAGCACCATGAAGATCTCCCACATCATCGCTCTTTGCGCCGTCGTCGTGGCCTCGACCGCTGCCCCCACGAACGCT
GCGTTCAGTTTGACGGCCGGCAACATGGCCGAGGACGTGCAGATCGCGCGTCAGCTTGGCGGCGGCGGCGGTCTGCGTGGCGCCAGCCAGCAGGGCGACC
AGTCTCAGAACACCCCGAGCCAGGGCAACACCAGCCAGGACGATGGCAAGCAGCAGAGCCAAGATGACGGCAAGCAGCAGAGCAAGGACGACGGCAAGAA
GAAGGAGAAGAAGGACGAGAAGAAGAAGGACAAAAAAGACAAGAAGGATGACGGCAAGAAGAACAAGGACGACAAGGACAAAAAGGAGAAGAAGGACAAG
AAAAGGATGACGGCGACAAGAAGGACAAGAAGGCAAGAAGGATGGCGACAAGAAGGACAACAAGAAGGATGGTGACAAGAAGGACAAGAAGGATAAGAAG
AAGGACGGCGACAAGAAAGACAAGAAGGACGACAGCAAGCAGAATGGCGGCGAAAAGCAGGGTTCAACCGAGAAGCAGAACGACGGTAACCAGTCCCAGA
AGCAGGGCTCGACCGAGCAGCAAAGCGAGAACCAGTCGCA