Description :
From Genome Similarity Track
Location :
contig_32:83463- 84903
Transcript NameFunction/comments
g7616.t1hypothetical protein

Sequence
1440 bases(100 bases per row)
GGCGAGCTTCGTCATCTTCTCTTTCGACATTGACGGGCATATTCGAGCGTTGTCGGATTGTTCACCAGACCGGAATTACATGCATAGGGAGAATACAACG
CGTGACGTCAAATCTCCACTTTGCAAAACTTTGAGACGTGCATTACGACTGGAAACAAGTTGCATGCACGGGACGCCGCAGAAGCGAAAGATTCCATTTC
GGATGTGCATTCTGCTGAAGCGTCTCGCTGCTTGCATGCAGCTACAGTATTCTAGCTTGCTGCTAAACGCAGCCCACGAAGCTCAACCGAGGCACTCGTA
GTTCCACGTATCGTAGGGGGGCGCGCTCACTACACCAATGACGAACTGTATCATCCTGACCCAAGCTCAAGCTCCAAGGTGGAAGCCCTCGCCGTATAAT
CAAGACGCTTAGGTATTGAGCTTTGTCACGAAACATCCAAGCTACTGCCTATACACTGTACATGTGACCACGCACCACCAAAGTAAGACATTGGTTTGAT
CTTCATCTCTCTCCTCTTCAACCCTGTATGTAACGAAGACGCGCACATCCGCATGAATATTGCACTCCATGGCAACAACTTGTTGCCCCATCAGATTGCT
GCTTGACACGGGAAAAACATGCAAGCGGGTGACGCGCGAGTTACGTTGTGCATGGAAGATATTGAAGTTGAGATGTGTTTGCTGTTCGAACGCACCGGAG
CGACGACGCAGACTGGCAGAGTCCCTTGCCCTGGAGCAAAGCTCATTCTGCAACTTACCGCGCCATACTCACAGCACTCGTGACTCCACCAGCCCATTGG
AAACCGTTTCCACTACCAATTTCCCAAGCACCATGAAGATCTCCCACATCATCGCTCTTTGCGCCGTCGTCGTGGCCTCGACCGCTGCCCCCACGAACGC
TGCGTTCAGTTTGACGGCCGGCAACATGGCCGAGGACGTGCAGATCGCGCGTCAGCTTGGCGGCGGCGGCGGTCTGCGTGGCGCCAGCCAGCAGGGCGAC
CAGTCTCAGAACACCCCGAGCCAGGGCAACACCAACCAGGACGATGGCAAGCAGCAGAGCCAAGATGACGGCAAGCAGCAGAGCAAGGACGACGGCAAGA
AGAAGGAGAAGAAGGACGAGAAGAAGAAGGACAAAAAAGACAAGAAGGATGACGGCAAGAAGAACAAGGACGACAAGGACAAAAAGGAGAAGAAGGACAA
GAAAAGGATGACGGCGACAAGAAGGACAAGAAGGCAAGAAGGATGGCGACAAGAAGGACAACAAGAAGGATGGCGACAAGAAGGACAAGAAGGATAAGAA
GAAGGACGGCGACAAGAAAGACAAGAAGGACGACAGCAAGCAGAATGGCGGCGAAAAGCAGGGTTCAACCGAGAAGCAGAACGACGGTAACCAGTCCCAG
AAGCAGGGCTCGACCGAGCAGCAAAGCGAGAACCAGTCGC