Description :
From Genome Similarity Track
Location :
Scaffold_138:83457- 88556
Transcript NameFunction/comments
g18593.t1hypothetical protein
g18594.t1POM79629.1 Transient receptor potential Ca2 channel (TRP-CC) family protein [Phytophthora palmivora var. palmivora

Sequence
5099 bases(100 bases per row)
GTCTGAGCCATTGATTGCCGAGCCAGCCGTGCAGAACCAGAACCGGAATCCCTCCAACACATCCAACAAGTCAAGAATGGCGCCGAAGAAGGGGAAGAAG
AACGCCAAGAAGGCCGCGGGCACGGCCGCCGCCTCGGACGACCTCGACGACCTGTTGAACGAGTTTGCGCCCAACGAGGACGTCAAGCAGCAGCAGGAGC
AGCAGCAGGAGGGGGACGACACGAAGCAGGAGAAGGAGTCGGACGTGGATGCCGCCGCTGCCGCGTACCTGGCGTCGCTGGGCGTGGCCCCCACCAGCGC
CGGCGGTGAGAAGAAAGACGACAAGAAGAAGAAGAAAAAGGGTAAGAAGAAACCTAATGCGGACGCCAAGAAGGACGACGACAAGAAGCCCATGTCGGCC
GCGGCCAAGGCGCTGATGGAGCGGCAGGCAGCGCTCAAGGCCGAGCAGGAGCGTCTGGACCAGGAGCGTCTGGAGCAGGAACGCATCGCTCAGGAGGAGG
AGGTCAAGCGCCTCGCGGAGATCGAGCGCGAGGAGGAGGCTCGTCGCAAGAAGAAGGAGGCCCGTGCCGCCAAGATCGAGCGCCAGAAGAAGGAAGGCAC
TTACATGACCAAGGCCCAGAAGCAGAAGGCCGCCAAGGCGCAGGCGGCTCTGGAAGCCATGCAGCAGGCGGGACTCGTGCCGGACGCCGCTGGCGAGAAG
AAGAAGGTCGTGTATTCGGACAACAAGAAGAAGAGCAAGAAGAACACGGAGCAGAAGAAGGAGGAGAATAAGAAGGTGGAGGCTAAGAAGGTGGAGGTAA
AAAAGGAAGAGGAGGAGGAAGTGGACGACTGGGAGAAGACGGAGGACGCCGCTCAGGAGGAGGAGGCTGAAGCCCCCGACGCCTGGGATGACGAGGACTG
GGAGACCAGCGACGTTGTGGCCTCGCTGGAGGACAAGCTGCACGAGGTCAAAGAAGAGGCCGCTGCTGCCGACAGCGACAGCGAAGGAGACGAAGATCTG
CTGGTGCTGGAGCAGAAGAAGGAGCAGGAGCGGCTGCGTCAGCAGGGTATTGCGCTGATGAAGCGTCAGGAGGAGCAAGCTGAGCAAATGCGTCTTGAAG
CTGAGGAGGAGCGTCAGCTCTCCAAGGCCAAGATGGAGGCTGATCGCAAGAAGAAGGAGGCGGCCGAGCGTCGTCGTAAGCGTGAGGAGGCTGCGCGTGC
CAACGTGTCGCTGGACAACCTCCGTTCCCCTATTTGTTGCATCATGGGCCACGTCGATACTGGTAAGACCAAGTTGCTTGACAACATCCGACGGACCAAG
GTGCAGGACGCCGAAGCCGGTGGTATTACGCAGCAGATTGGTGCGACGTTTTTCCCCGTGGAGGCTATCAAGCAGAAGACGGCGCGCCTCGCCGAGACCA
TGAAGCTGGAGTACCGCCTGCCCGGTCTGCTTGTGATTGATACGCCTGGTCACGAGTCGTTCACGAATTTGCGTACTCGTGGTTCGTCGCTGTGTGATAT
CGCTATCCTGGTGGTTGACATCATGCACGGTCTGGAGCCACAGACTCTGGAGTCGTTGCGCCTGCTGCGCCAGAAGAAGGCCCCGTTCGTGGTGGCACTG
AACAAGATCGATCGTTGCTACGGATGGAAGGCAATGCCCGACATGCCAATTCAGGAGGCGCTGAAGCACCAGAATGAGCACGTCATTCGCGAATTTGAGG
ACCGCATGAAGTCGATCATCGTTGAGTTTGCGGAGCAGAAGCTGAACGCCGAGGTGTACTGGCGTAACAAGGACCTCGCGCGCACGGTGTCGCTCATTCC
TACTAGCGCTATCTCGGGTGAGGGTGTTCCGGATATGCTGATGATGTTAACGCGTCTGACGCAGGAGCGCATGGCGAAGTCGTTGGCATTTGTGGATATT
CTGCAGTGCACTGTGCTGGAAGTGAAGGTAATTGAGGGTCTTGGCACGACGATTGATACGATTTTGGTGAATGGTTCGCTGGAGGAGGGCGCGACGATTG
TCGTGTGTACTTTGGACGGACCCGTTGTGACGACCATCCGTTCGTTGCTGACCCCGCACCCTATGAAGGAGATCCGTGTGAAGGGCGAGTACATCCACCA
CCAGAAGATGAAGGCCGCCATGGGTGTGAAGATTTGCGCGCAGGGCCTGGAGAAGGCGGTGGCTGGCACGCAGATTTACGTGGTTGGTCCCGATGACGAT
GTCGAGGAGCTGAAGGACTCTGTCATGTCCGACTTGACAGGCATTTTGGATTCCGTGAAGGCTACCCGCCGCGGTGTGATGGTGCAGGCGTCCACCCTGG
GTGCTCTGGAGGCGCTTTTGGAGTTCTTGCGCACGTGTGACCCGCCCATTCCGGTGTCGTGCGTGAACATCGGACCTGTGCACAAGAAGGACGTGATGCG
TGCTTCCGTGCAGCTGGAGCACCAGCCCGAGTTCGGCACCATTCTGGCATTCGACGTGAAGGTCCACAGCGACGCTACCGAGCTGTCTGCGGAACTTGGC
GTGCGCATTTTCACGGCCGATATCATTTACCACCTGTTCGATCAATTCACGGCGTACATGGACAACTTCCGAATGGCGCGCCGTGAGGAGTTCGCGGAGG
TCGCTGTGTTTCCGTGCGTACTGAAGATCCTGCCCAATTGCGTCTTCAACAAGAAGGACCCGATCATTCTCGGTGTCGACATCGAGGAAGGCATTCTGAA
GATCGGCACGCCCCTCGTTGTGCCCTCCGCCGGCGGCTTCCTGGTCGGCAAGGTGGGCTCCATCGAGCGCGAGCACAAGGAGGTGGATCGCGCCAAGAAG
GGCGCGTCCGTGGCTGTTCGGATAGACAACGAGGGCAGCGTCATGTACGGCCGCCACTTCGACCACAAGGACAAGCTGGTCTCGCGTCTGACGCGCCAGA
GCATCGACGCGCTCAAGGAGAATTTCCGGGAAGATCTGCAGAAGGAGGACTGGCAGCTCGTCATCAAGCTCAAGAAGGTGTTCGATATCATTTAGAGTGA
GCGTGTCCCGCAGGAGCGTTTGTGTCCAGACGCTGGGCCAGAGGGTGTCTCCTTGCCGCTCGACGGCGGTGTAGTTCTTGTCAGCGGAGACCGTTTCGAA
TATATGATTACATCTCTTTTCGTCGACATGTTAGAGCTCGAGGCTAGAAGTCAGCGATCGTGACGCCGTGCTCCGGTCACCAGCCTGGACTTCTGTCAGG
CCTGTGGGCGGCAACTCGAGGCACGTCAGGCAGGCGAATCAGCTCCGCCTTACCGCACCGGAAGGAGCAGCACCGGGTGCCTCGGATGCGTGGCGTCGGC
CCGACATATACCAATTGCCCTCTGGTCTAGTGCTCCGTCACAGAGCGTCAGGGCCAGGACGTCGTGACCAGGACGCAGGATTTTCTGCTAGTGCCCAGAC
TGCTACTTCACGACTGCTGTACGGCGCGCGCTGCGTCGTTCTGTGGCAAGAGCGTTGGGCGACTCCGGCGCCGCATATGTGACTTCGGGGCTTGGCATCA
GCAACGTCCAGTGGTTCATCTTGAGGCCTCAGTGCTTGTACTCGTCCCAGTTGCAGACGAAGGCTGTGAATGAGCAGCATCGCCGCATTGTGTATTGTAC
AGGCGAAGTCTCTATACCAGCGTTTGCTAGCGCAACAGGCTGCTTGGGGCGGTGACGAGCCCAGAGTTGAGGGTCGCGACTCGTAGGAGCTTCGCGGCGC
CAAATGGGAAACTGGTAGCCAAAGCCCCCCCATGCAACACGGAATGCCGAGTCCCCACTATTGAAGCTGAACAGATGGAGCGGAGACGAATCTGTCCAGG
AGGGACAGCCGAATGTAGACTTGCGCAAGTCACAGCGCGGCGGACGAAGCGCGCAGAGACCTCCCATCTGAACCGGGAGAACCTCGCAGTCCAGCGCGCG
CTGGCCTTCACGGCGAAGCAACATGCAACATGGAACGTCGGCGTACGTGGAGGGGCTCCTGTTGTGTGTGTTTGTGTGGGTAAGCGCTCTGGTCTGGTGG
TGGACGCGACCCACTGCAAAGGTAGCTGCAAAACGGCGGCATGCAGGCTCGACTGTACCTGCCTCACTTCGCAATTGGATCTCCTCCGAGCAGCCCCGTT
CCCCCCGCCTCCCCCCTACCGCGACGGAATGATGCACAGAACGCGGATGACCCCCATGCAGCAGCTCAATCACCCGGGAGCCGCCTCCAAGTCGAGCTCG
CTCCGCGCCATGCGAGTGCCCAAGTTCCTCCGTAGCCTCTACGACATCCTCCACTACGAGGACCAGTCGATCCTGACGTGGTCCAAGGACGGCACGTACT
TCCAGATCTTCGACACCAAGCGCCTCGAGGTCGTGGTCCTGCCCAAGTACTTCAAGCACGGCAAGTTCGCGAGCTTCCAGCGCCAGCTCAACAACTTTGG
CTTCCGCAAGTGGACCAAGACGCAGTCCAGCGTCTGCACCTTCAGCCACCACCACCTCGTGCGGTGCCACCCGCAGCAACTGGCCGAGTTCATCAGTCGC
CGGCCTCCTGCCAACGGGGTGCGATCCGCAGCCGACGCGTCGTCAACCACCAGACGCAAGCGATCGTTCACGGAGCTCATGCGAGCAGCAGACGTCGGGA
GCCCCGCCTCCTTCAAGACGATCAAGCGTGAGACCGACAACTTCAACCGTGGAGTACAAGCTCAGGAGAGCAGCGCAACGAGCCCCATCCCCGCCAAGGG
CGCACCGCGATGGGCAGCCGACCCGATCGGGTTCCTGAAGGCGAGCGAGGACACCAGCGGAACGCCCACCAGCACCTCGTCCGAACAAACCTTCAACTTT
TCAGTGGAGGAGCTGCACGACATCATCCTACCCGCTCCCCCCATTTCGGAGCGCCAAGATAAGATGCTGGAGCTGCGAATGCTGAACGAGTGTCTGGAAC
TCGGGACCGCGGGTACGTTGTACGCGGCCGCGACTCATGCGGGCGGGGAGCTCTTCCCAACGCTTCCGTACTCGTGGGACAGTGACACATTTTTCGCTCC
GGTCGGCCGTACGCTCTTCGAGCAGGAGCGCGGGCCGTGGAGACTGCACTAGAGCAGCACCCTACCATAGCGTTTCGAATTAGTTAGAGTAAGTAGTAA