Description :
From Genome Similarity Track
Location :
Scaffold_418:8345- 11771
Sequence
3426 bases(100 bases per row)
TGCATTAATGCACAGTCGATTGAAAAGTCACTGGCATCACAGATCACGTAGAATGTCCTGGCTTGGTCTACATTCGCCAAAACTGGCGATTATATCAAGA
TTAGCTTGATACCTTTCAATGTGCGCTGGCAGTCTGCACTCCATTCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTA
ATCGCGTGAATATTTGTGCAAATACGCCGCTAGGCCAAGGAACTTTCGAAGTCTATTGACATCTGTATGCACCGGCGAGCCGGTGATCGCCTTGATCTTT
TCTGGATCGGGCCGGACGCCATGCTTGGCCACGATGCAACCAAGAAGTAGTATTTCGCTAGCAGCAAATATACACTTCTTGATGTTGGCGTACAACTTAT
ACTCGCGCATTGGTGTAAGAACCTTCCGGAAGTCGAGTCGGTGTAGTTCCACATCCGTCTGTCCACCCATATCCCGGCTATGGACGAACACATCATCGAA
GTAACGAGGTGCGAACTCTCGTACGGATCTTATTAGATTCGTTACACATCTGTTGAATGTGTCGGGGGCATTACTAAGCCCTTGTGGCATTAGAAATCAC
TCCCAAAGCATGCCGCTTGGGGTGCTCACTGCAGTTTAGGGAATGTCCCTTTCACGCATAAAGATCTGATAGAACCCATCCATCAGATCCATGGATGAAA
AGATGGTACTCCCTTAGCCATACCATCTATGATCTCATCTTTCCTTGGTATGAGTGTTTAAGCCGGTACAGTGGCAGCATTACACTTTTTCAAGGCGTGT
ACTATCCGCCAATCTCCCGTGGCCTTTCACACACAGAAGGTCGGAGAGCTATGTGGAGAGGTGGACTCCATTACATGGCCGGCTGCTAAGAGATCTGCAA
AGAATTTGTCGATCGCTAGTACTTGTTCACGAAGCAGTGGCCATTGCGTCATGACACAATACTTCGACCCGGTTTCAGGTTGATTTCGTGGCGATTACCT
TTGTACTTAGGTAACTCGCACGGGACTACTTCTGGGAATACATCCCTGAATTCCATCAAATCATCGTAGAGAGGATTTGCTATGAGAGATTCCCACGGTT
GGGATGTACATCGCTCAATCTGATTCTTCCCATCAAGGACAATCTCGTCCATTGATGAGCTACTGAGAACTCGTTCATCTTCGGCAAAGACCATTGCCGA
TCGGATATCACTGACGTACTCATCTTCCGCGATGAGTTCGCAGATCTGATTGACTTTGCCACGACGCAGATCACGCAAGAACCTCTTTTGGCTCAGCGGG
TAAACTGAGTGATATCCTAAGTTAGATTCGGAGGCGCGATCAGATCAAGCATATGGCTACCTATGATTGATCCGTCATTAATCAGGACATTCAATCTCTC
TGTCATCTCATGGGAACTGGTTTCCACTGTTTTTTGGGAGCTTATTCCCTCAACTCTAGCCTCTTGGGCTATTTCATCTCCGTATTAACCATCATTATCA
ATTAATTGGTCATGATCTGGGTGTTGTATATTAAGGAGGCAACCATGCCCCGGTCCAATCAACCTATTTGAGAGGTGGGCGTTCGGCGCTTCCTGCATTG
TTATGCTGTCGCCGGGATCTTGCTCCGCAATATGATGGTTAGTCATATTGTTTGTTCTTGTGCAGTCGTACTAACGACCGAACCACACGTGAGGCCATCG
CACTTACTCGTAGTACATCCATATGGTGGTGGAAGCTCCAAGACGTTCATCAGATGGGCGTCTGGTGAACAAGCGGCGGGCATATCGGCACTTCGTCGAT
GTCATCTGACTTGTGGCTCGTACCTTCTGAGCCGCGGTAAACCAAGGATAACATCAAAATTGTCAGCTAAGTCCAAGCCGATGAAGCCATCATCTTATTG
GACTTCTTTCAGTGTATAGGAAATTACTACTACACGTTTCATCACTGTTACGGATGCGCCTATGGCGAAGCGTACCGTCATCCTCGTTAGAGGAATGTCG
TGCTCGATGTATCTAAGCCTGATCTTTTTAGCGACTGGCTTCGTCCAAAGTTTTTTGATGCCCCACAATTGACTAGGGCTCGTAGTGACATGTCCTTTGC
CACTTCGAGCTTCAAGGTAATCAGGGAAACCTCATTACAAGATGCAGTAACGCAATGATTGCGTGTTGGGAGCAATTCTCATTAAGAGGCCTGCAAATTA
ACTTGACGTTGCTGAATCAGTTGAGTGCTTTGCACCTACTGACCCTGACCGTTTTTGATCGTCCGTTACGGTGTTACGTTTTCTCAATAGTGTCGGACCC
ACGCCTCGGACCCTTCTTGGCCGCTTGACGGTTACTGTTTCATACGGTTCGTGGTACCGCGTTCAGGGCACTGCATTCATATGCATAATGACCTGGCTTT
TGACACCAATTGCATGTCTTCAATTTCTTATAATTGGTAACGCGAGAGCTTTCACTCTCAGCGTATCAGAGGTCCATCGGTTCTGGGCCTCCGCTTTCCT
GTCGTCTCGATGGACGATAGGAGTTTGAACTCACGTGAGCTTGTTTCACGCTGAAATATTCATGTTCCATAACTCAGATTACCTCTTCCAGGGTATCAAA
TTCCAACCGGAAGAGATAGGTTCTGACTGGACCGTCTGTGAGACCCTGCATGAACAACGTGATCAACGTTTGTTCATTCGGCGGATTGGACGTGATGCAA
CTCGTAAGATGACGTATGTACTGAATGTACGAGTGTACATCACGTTTGCCTTGTTTGAGTTTCAGGAGTTTAGAGCGAGCCCTGAACTCAGGTCGCGGAG
ATTCAAATATTTGCCTAAGCAGGGACTTGAAGACTTCTAACGACCCAAAGACAAATGGGTCGTGCAGCTTGAGGCCCAAGGCCCAAGTCTTCGCACGCCG
TACCAAGTTCGACTGAGCAAACGCAACCTGCACTTGCTTATCGACGATGTAACGAGACCTTATGGCGTCATCTAGCTCAGCAAACCGTGTCAGCAGAGGA
TCTTCTTCAGCTGCTTTGTATTTGGAGATGTCAATCTTCAGTGATTCGGGTCGACGTGAGTGTGTCGACCCGGTGGCAACAGTCTGCTGCTGTATCAACA
ACTCGAACTGTTGATCACTCTATTCTCTCAACAGCTCTGTCTGTTGAAACCCTTGTTGGTGAAGCAAGGCTATCTTTCTCCGTTCAGCGTCAAGTTCATT
CGAATAAACTTGGCGATGGTGGCGTGTTGCCAGTATGGACCCAGAGCGGACAGCACTGCGCCTACGGCTTCTTGTTCTATCGTCAAACTCAAGCGTTCGA
CAGCATCCCATTCGATTTGACTCAAATGGGAGTAGCTCTCGTGCGTTGGATAGAAGTCTTCCGCTTCATCATCTAACATGTTCATAGTCATTGGAAGGAA
TACTAATTGCTACCAGGTGTAACGGG