Description :
From Genome Similarity Track
Location :
Scaffold_13:83431- 86397
Sequence
2966 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCTCGGGCGGATGAG
TGTGGTCATGATGATCCGCCGTCGATTCCTGATGAGCCCGTCCCTCAACCGCCTCGGGGCGTCAATGCAGAGCTCATACATGAGGCTAAGATGACGCACC
GCTGCGGTTGATCTCTGATCCAGATCAACACATTCAAATTCAGCCGCCTGTAGTCGACACTAAGGCGGATATGTGTAGGCATGAGTATCCACCGTCGGAT
CCCGACGTCCGGTGCCCAAACCGTCTCAGTTCGTTTATGCAGAGCTCATACAAGGGGCCAATAGTCGCGTTCCACTTTGGTTAGGCTCTGCTCCTGATCG
ACACATTGAAATCCAGTCACCCGTAGCCGAATCTCGGGCGGATGAGTGTGGTCATGATGTTCCGCCGTCGGAACCGGATGAGCCCGTCCCTCAACCGCCT
CGAGGCGCCAATACAGAGCTCATACAAGGGGCGAATGGCCACGTTCCGCTTTGGTTAGGCTCTGCTCCTGATCGACACATTCAAATCCAGTCACCCGTAG
CCGAATCTCGGGCGGATGAGTGTGGTCATGATGATCCGCCGTCGGAACCGGAAGAGCCCGTCCCTCAGCCGCCTCGAGGCGCCAATACCGAGCTCAAACA
AGGAGGGAATGGCCACGTTCCGCTGTTCTTAGGCTCTGCTCCAGATCGACACATCCAAATCCAGTCACCCGTAGCCGAATCTCGGGCGGATGAGTGTGGT
CATGATGATCCGCCGTCGGATCCTGATGAGCCCGTCCCTCAACCGCCTCCTGGCGTCAATACCGAGCTCATACAAGGACCGAATGGTCACGTTCCGCTGT
GGTTAGGCTCTGCTCCAGATCGACACATTCAAATCCAGTCACCCATAGCCGAAGCTCGGGCGGATGAGTGTGGTCATGATGATCGCCGTCGGATCCTGAT
GGGCCCGTGCCTAAACCGCCTCGGGGCGTCAATGCAGAGCTCGTACATGGGGCGAATGACGACGCTCCGCTGTTCTTAGGCTCTGCTCCAGATCGACAGA
TTCAAATCCATCCGTAGCCAAATCTCGGGCGGATGAGTGTGGTCATGATGATCCGCCGTCGATTCCTGATGAGCCCGTCCCTCAACCGCCTCGAGGCGCC
ATACAGAGCTCATACAAGGGGCGAATGACCACGTTCCGCTTTGGTTAGGCTCTGCTTCTGATCGACACATTCAATTCAGGCACCCGTAGCCGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGGTCATGATGATCCGCCGTCGGATCCTGATGAGCCCGTCCCTCAACCGCCTCCTGGCGTCAATAC
CGAGCTCATACAAGGACCGAATGGTCACGTTCCGCTGTGGTTAGGCTCTGCTCCAGATCGACACATTCAAATCCAGTCACCCATAGCCGAAGCTCGGGCG
GATGAGTGTGGTCATGATGATCGCCGTCGGATCCTGATGGGCCCGTGCCTAAACCGCCTCGGGGCG