Description :
From Genome Similarity Track
Location :
Scaffold_107:83420- 91342
Transcript NameFunction/comments
Phyci_13011Hypothetical protein
Phyci_13012enhancer of yellow 2 homolog (Drosophila), isoform CRA_b
Phyci_23883330S ribosomal protein S16, putative
Phyci_238765Hypothetical protein
Phyci_238734Hypothetical protein
Phyci_238733Hypothetical protein

Sequence
7922 bases(100 bases per row)
TGATCTGCGAGTTGAGCATCGTGTTCTGCTGCAGTTGCAACTCGTCGGCCGGGAGGCCCACGCGGTTGCTGATAATCTCCGCGATCTGCTCGCGCGAGTC
AAACGCCTGCACCGATAGCAACAAAACATTGCAAACCGTCAATCCAAGCCAAAACCAACCACGCAACATCACTCAGACAAACACACCTTGAACGTGTACG
TGCGGGAGGAGACTCCGAACTTGAGCACCGAGCCGTGCACCACGAGGGTCGGCTGCAGCGCAGTCAGCCGCAAACCATCCACGAACGTTCCGTGAGCCGA
TCCAAGGTCCACCAGGTAAGTCGCCCCCTTTTCATGGTGCACGATCGTCGCGTGCAGCCTCGAGATGGAGCAGTGGCTCAGCACAATGTCACACACCGCC
GCGTTGCGCCCGATAAGGTAGAACGCCTTCTGGTCCACCGTGTGCTGCACCAGCCACACAAAAAACACTAAATCAGCGCGCAAATTCCCCCAACATTCCC
CTTCCACCTCCCCACCAAACGCACCGTGGCAATGAGCACGTGCTCCTTGTACACGTCCAGCAGCGAAATCGACCGCGGGGGCTTATGCATGCACCTTTAA
AACCAATAAATCGTCAAAGAGAGAGAAAAACGGTGCGACACGTAAGTAAAATAAACTTTGAAGTTAAGCGAGGAGAAGGGATAGCGGGGGGAGGAATTGA
ACGGTATCGCACCATGTCGGCGGCGGGAACGGCATCGTGGGCGGGTCGATGGGGTCCAGGAACTTGGGCTGCGCCGCGAACGTGGGCAGGTGCAGCCTCG
GCAGCTGCAGCGCCTGCTCCATTGTCTCTGTGCTGCCTGTTGCCTGCTGCCTGCGAGCTGCTGCGAACGAAAGTCCGTTCGCGAGTGTCCGAGAGTCTTG
CGGCGCTAGGAGAATCGCCCAGTGGCCGACCGGGGGAAACGGAAAGCGGTTCTCGACGACGCGACGCTGCGGTCGTTCGCCTGCCTTCTCTCTCTCTTCT
GCGAGTCGCGCGCAACAAGCGGACGAGCGGCGCGGAGCACTGGGCACTGTGCAGGCTGTTGCGGTCGAGACTCGAGTCCCTCACTGCAGGCACCACGACC
GGACACTGCGCGGCCCGGCTCTGCAGAGGGCAGAGGGGGCAACGACGTGACGTAATTGGTCCAAACGCATCGAGTCAGACCAACGTCCCCCCCTGAACTC
TATGCGGTTGCGCAGGTCGCCCCCACAATAGATTTTCTATTGGGAGCGAGGAGAGGTAGCCATGCGCTAGCATGGGGGAGGGTGTTTGGACCAATCACGA
GAGAGACCTTTTCCCGCCAATCGCCGCCGGAAGGCTGAAGTGGCGGATCACGAGGAGCTCCGCAACCGGATTGAGCTGTACGTCGACGACATGGAGGAGT
AAGTGTGCAATACGTGTACTGTACTGTGCGCTGCTGTCGTTGCGCGGTCGTCTGCCGCCGTCGCGCGGTCGCGGCTGGCGCGATGAGTGGAAGGGTCTGA
TCGTTTCGCTGCCTGCCGCTTTGAAGGACGCACGCCGCGCGCCAGCGGCAGGACGAGCAGGTGAAGGCGCGGATCAGCGAGCGGCTGGTGCAGAGCGGCG
AGAAGGAGCGGCTCAAGGAGCTGTTGCGCCTCAGGCTGGTCGAGTGCGGCTGGCGCGACGAGATGAAGCTGCACTGCAAAGGTGCTGGCTGGCTGCAGTA
GTTGAACACGCGCCCTTTAGTCCGTTAGGATTGCTACTGTAGTTGGAGGAGGCACTGTGAACTGAGACCGTGGGTTGCTGGCGGTGCTTGATTGCCAACG
CGTAGAGGTGATCCGGAATAAGGGCATCGACCAAGTGACCGTGGAGGATCTGATCGAGGAGATTACTCCGAAAGGAAGAGGTGAACGCCTTCGAACAGGC
AGAGAGAGAGGACGTAGTTAGTGTACAATACTGACGGTGCTTTTGTTGTCGTGCACTGCTGCGTTGCCACTGCAGCGTCGGTGCCCGAGGACGTCAAGAA
CGACTTGCTGGAGAAGATCAAGGCGTTCATCGAGAAGGAGGCGGGCGACGTGAAGCTGGACGCCAGCAGTTGAAGCCATAGAGCAGACACGAACTAAATT
CGCAGCCGTCGGCGCTCACGGAGCCGCGGATGGCTGCGCACGCGGCATGTACTACAGCAGGCAGGAAAATCCAGCGGAAATCACGATGACAGCGTAGTGT
ACCACATGATGGCGCGTTGCCACTGCTGCTGCTGTTGTTGCTTTCTTTCGCGCTCGCCGGCCGAAAAGCACAAAATTCCGAATCGAATATTTGCAAATTC
AAACCAAAAGTTGCCAAACTGCATAGTGACGGGTGTCACTAATGCGAAACGATATTGTGCGGCCCGAAGCCACCCACTCGCACAAGCAAGAGCTCGGACG
ATCATGGTGGTGAGACTGCGCCTGGCCCGCTGGGGCCGCAAGGACCTGCCCTTCTACCGCATCGTGGCTGCGGACGCGCGCGCCCCGCGCGACGGCAAGC
ACCTCGAGATCGTACGTGTGTTGCCAATCTTCCCGTAACCGCCGGTTAGCACTAGCCTAAACGTCTCTAACCTTGTTGCAACTTTTGCGCAACAACTTGC
AGCTCGGCACGTTCAACCCCATCGCCGCCAGCGACGGCGTCAAGGAGCTGCGTGTGAACAGCCAGCGCGTGCGCTACTGGATGTCGGTGGGCGCGCAGCC
CTCGGACCGCGTGGCGCACCTGCTGGGCCTGGCCAACGTGCTGCCCATGCCGCCCACCCGCCAGTACACCAAGAAGAGCGTGCCCAAGAAGGACCGCGAG
TAGACAGAAACCAAGAGGAGAAAGAGAGAGGGGGATGGGCAGCGGTAGATGGCAACAAGGAGAGAGATTCATGTAACCTTGTGTGTCGGAGCTTTCCAGT
TTTTTTTTTTCAGTTTGTACAGTATGCAGACACCGAAACTTTCGCCAATACGTTGAAGGCTGATATGCACCAGTTTGAAGACAAAACAGTCTGCTGTGGG
GTTATTGGCACGGCAAACCGGCACTTGTGGGCGAGTTTCTCTTCGTACGTGGGCGACACAGTTTGTCTCTGTTACCTCCATCTGAGTGCGCCAGTATCGC
GGCGAAATGGATGAATTACCGGAGCGCGCATCTGCAAGCGCGATGAAGGGGATGCCCTGGTGTACCTGAGCAGTATTCAATGGACAGATTTTCTCGCAAC
AACGAGCTTGCCTCATGATGTCGGTTTGCCCCAGTGATCGCGATCTCCAGAAGCAATTTTATGAGTCGGCATGCGCACTCACGGACGTCTAAGCTTGAAG
AGCTGGGGAAGTGGAAGAAGCCGAAGGTGGAGACTTATGTAGTGGCGGAAGGGTGAAAGGAACTCACGCCTGGAAGTCTTGCAGGTGGACGTGCATTTTG
AGCTTAAGCTCTCTCTTCGCTCGGAGCTCTTTCAGACTCTGCCAGCAGTTGAACAAGATCGCGCGCTCCTCCTTCTCGAACCGACTACAGAGGCTCTCCC
TGAAGTGAAGGTACAGCGGTCGGGCCTAGACGGCCCCGAAGCACTCGTCGGCAGTTGAATAGAGCCTCAGATGCGGCGGCGGGGCTGACACAGGCTGCTG
GGGTGCGACCAGCACTGCCTCGGCTTGCTGCGGCGGATTACCTTGCTCTCTCTTGGGCATGACATCGCGCGGTTCGCCACGAATTGAATACTGAGAACGT
CGCTGCCATTGCGATCGTCGGTCCTAAGGGAGCATTGAAGTTGAAGTGAACGGTGATGTATTGTGTAACGGTTGGTGTTGATAACTCACGATGACTCACG
ATGAAAAAGGCAACTTTGTCTATTGGAGTGTGTGTAGTGAGTGGTGGGTAGTAGCGAAAACCTAATGCAATTGCTAGTAGAGCGGCGTAGAGCGAGCCAA
CGCCTACTTCCTGGGTGTAcgcgcccgcggcgccggcccgcgcgccgAACCGCCGCCCTTGAGCATGTTGCCGCCCTTGCGCACCTGCTGGTTGAACGTG
GCGTTCTGCTCCTCCATCCAGCGGCGGATCTCGCGCTGCTTCTCCTCCTTGGCAGCGAGCCGCGCCTCCTCCTCCTTCTGCTTCTCGCGATGGATGAACT
CGGCGTCGCGCCGCAGCTCGCGGGCCGCGCCCTTGCGTGCGCGCTTGACCTGGCGCTGCAGCTGCTTGAGCTGCGCCGTGTCCTTGGGCGCCGTCTTGTC
CTTGCGGACCGTGTAGTTCTCGTCGAACAGCGGCGCGAACGTCGGCAGTGTCGTCGGCGCGAAGCTCTGCAGGCGCAGCGGACGACGCGCGCCCCAGCAC
GACTCGAGGCGCTTGTGTAGCTTGGAGATCACGGCATTCACCTCCGAGACCTTGGAATCCTCCAGCTGACTCACCAGCGCGTGCAGCAGCAAGTACAGCG
GGTAGAACAGCTCGTCGAACGACGGCAGCGACGCGTACTGGGCCGACGCGGCATCCAGCAGAGCCAGCAGTGAGCTCAACACTTGAGCGCCGCTGCAGGA
CGAGCTGCCAGCCAGCGACAGGCGCGGCAGGGCAGGCATCTTCTTCTTCTCCTCGGAGTGGGCAGCCACCCACTCGAGCAGGTCACGACGCAGCCAGTGG
ACCGAGGAGGACTTGCAGTCGTCATGCTCTTCATCAGCACCCGACGTCACGAACGCGCGGAGGATGCGAGTCAGGAACGTCACCACCTCTGGCATGAAGC
GCTCCTTGGAACGCGTCATGTCCAGCGACAACGACGCTGCGAACAGCGCCTGTGTGGCCGCCTGCGGAGAGCTCACAGCACCACGAGCCAAGCTCTCGCC
CAGAAGCGTCTCCATGGGAGACACCACGTTGTGCCGCAAGTCGGAGGTCGGGAAAATGGAGGTCAGTGCCTTGAACAGAAGCAGCTCCGGCAGCGTGGGC
CACGCCGAGGTCGACGCACGCTTGTGCAACCGCTTGAAGAGCTGAGCCAGAAGCTCACGCACAACGACACCGGCAGTGTCACCCATCTGCTGAGCCAGCG
AGTACATATTCCTCGCCAGCGAGTCCAGCTGTAGAAAACAACAAACAACATTAGTACTCGCTGTAAGCAATGCACATAGCTGCAGGCAGAAGTAAATCAA
CGTACGTCTTCCTTGTGTGCTGCGTAACGCGCCGCGAAGATAAGGAACTGGCGCACCATCACGGCGAAGAAGCGCTTCATCTTGTTCTTGTTCTCCACGC
TCAGGCGCGGGTTGTAGAATGTGACAATGCGGTCCAAGATGAGCCCGCGCTTCTCCGGGGAGTTGCGCGCGTGCTCCTTGAAGAGCGCCGCGAGCTCCTC
AGGGGACTCCGGGCACTCGAACACGAACGGCAGCTCGGCGGCAGcctcctcggcatcctgcttcctcttttgcttctcagtctcttcgtcactttcgtct
gcgtcttcctcctcttcctcctccttctctttcttcaccttgggttcgtcttcgtcgtccgactccgcttccGAGTCGGGctcctcctcctcctcctcgc
tctcctcctggtcctcctcattctcgtcgccatcctccgcctccacatcggcctcttcctcctccGCGTCAGCATTAAAGCGAGCATCGACAGCGTATCC
ATCCGTCAAGTCGTCATCCGTGGGGGGCATGATGATGAGCTTGGGCGCCTTGTCCTTGGCTTTCTTCTTGCCCTTCTTGCCCTTCCGCTTGCCCTCGTCC
TCGCTGTCACTGTCGTCCTCGTCAGCGCCGTGCATGCGCGCGACGCGCTTCTTCTCCAGCGCCGCAAGACGGTCGCGCTCCTTGGCGGCCGCCTCCTCGG
GCGACATCCTGCGCTCCGTGGCCTTGGCCTTGGCCTCGAAGGCGAACTCCCTCGTGAGCTTGTCGAAGTCATCCATGGGCTCCTTGGGCAGCAGCTCCTT
GCCGTTGGCGCGCGTGGGGCGGAACTCCAGCAGGCCCTTCAGGTCGGCGAAGCCCTCGTCGAGCTTGTCCGTGGCGTCCTCCTGCGACGTCTTGTTCTTC
TGGCGCTCGGCCTTGAACATCTTGGCCTTCATCATGACCTCCTGCATCACCTCCTTGTGGCTCTTCCTCTTGCCGTCCTCCGCCCGCGTCTCGGGGGCGT
CGGCGTCTCCCCTGCCTCCTCCAAAGTGGAGCTGGTTGACAATGTCCCTGTCCATCCTGCGGCTCTCCTCCGAGTCGTCCTCGTCGTCCAGGGGGCCGTC
GGCGTTCAGTCGGTCGTAGTCGTCGGCCGTGATCTTGGCGCCCTTGTGCGTCAGGAAGAGCGCGTCGTCGTCGTCGTCGCCCTCCTGCTCCGAGTCCGAG
TCGTGCAGCGCGAAGGCCGCGGCGTTGCGCAGCTTGCGCTTGCGCTCCGTCTGGAAGCGCGCCATCATCTTGTCCTCCACGGACAGCGTCGGGTCCTGCT
CGCCCAGCCGCCGGTCCTTGAACACGTTGCTGCGGTGGCGCGCCTGGAACTCGGCGCCCAGCGTCTTGCGGCGCTTGCGCTCGGCCTCGGCTCGCGCCGC
CGCCACGTTGCGGCCCGCGCCCTTGACGCGGCGCCCGAGCACCTCGTGCTTCTGCTGGCTGGCGTTGCCCCGCACGTCGAACGGGTTGGCGCCGCGCGAG
CTGCTGGCGCGCACGAAGCCGCGCTTCTGCTGCGGCTGCTGCTTCTTGGCGCCCGCCTTCTTGCCGCCGCCCTTCTTGAACGCCATGCTGCCGTGGACGC
TGCGGACTGCGACGAGCTGCGGCTCGAGGTGATGTGGTGGCCAACCGTTGTCTGCTGTGACGCTAGTGACGTTGCGGGTACTTAGCCGAGAGCGGAGACT
TAGTGGGGAGCGGAGACTTTTGACCagggattggtagtaatatggatttcaccgctaaaggaatagtaataattcgggagaagatttttttatttactaa
ctatcttagtattactacttaggtggatgaaaaaattaatatgaataaatgtagttactaatagtaaaacaaactactataacgcccttaccacagattc
cgctcgtccgttcaatctctacgtcgttgttatgaagaactagctggcgctgggctcgctcaatgctcgcgggtgtgcggagaggactcaatgcaaacga
acctgtcgaaaagactcttaaaaacctgttgaggagcaagggcCCGacgtctgcgttttctagctgagctaaattgcatagtccagctgatctaaccatt
aaagtgcagcatggtagcgagcaatatcccgtttgctcggaaacatggattgccacgcacccaaatgaattccaagcttCTTCcgcgcatagtagctttt
gctcacaacgcggcgagactccttccgggcagcagcacgagcgaacacggagcgacgatcacacttaaacttctttgcaagatgcttcttgaggccctgc
gacgtctttaacttgcgccggcactttggacacgtcgtggttgcgtacagtttaggactaccttcctccgccccgtgccgctgaccttcgtggtgccaac
taccgtgtcactggccttccgagcgccaacaacttcaCCGCTGCGGAGCAACCTATGCCATGTCTGCGACGAGGTTGTTCTTTGAGAATATTGCCGCGGC
CCAAGttgatattttaacctagtcctacaaaagtgagtgcttcttactcgagcctgtccaggaaacgagtgagtggacttcactcacttaatataattcc
tcTTCGGTTTACCGTAGCAGTTATATACTTGCTTATGCAACCTACTCCTAGTTGATCGCTTCTTATTTGTTGAAAGGACTTTTGGGAGGGTGGCATAGTG
GCAGGTGATGTAGGTGACACAATTCAAAATTAGGGAGCGATCTACTGGGGCGATCGATCCGACACCAAGTATTTGCGAAACCAGATAAACAGCGATTCTA
GAAGCGTACGTTGAAGCCTATG