Description :
From Genome Similarity Track
Location :
Scaffold_19:83407- 84484
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10188hypothetical protein

Sequence
1077 bases(100 bases per row)
GGCGACCACAGCGAACTTCGCGCCGAGAGTGTCGGCGCGTCCAATCGACAATACCCAAGTGTCGGAGTTCGTTCTACATCGCCAGGCACTCACGCGATTC
GTTCGTGACGCACTGCAAGCAGCGGTTGACAAGCAGAAGGAGAACGCAGACAAGCGCGGCAGGAAGAACAAGGCCAAGTTCACGACAGGAGAGCGTGTGC
TCCTGTCGACGGACGGTATACGAAACTCGGCAATAACCAACCTCGGCGCGAGCAAGCTCGCACCACGCTTTATTGGACTGTTCAAGATTACGAAAGTATT
GGGCGATGCCTACACACTAGACATACCGACGTCGTTGAGACTACACCCGACGTTCTACGTTGGGCGACTGAAGAAGTACTTCCCAGGTACGATCCCTGCG
ACGGCTCAGACGGCTGAGCCGGAGGCGCGTGGGTCGTCCGTCCCTCGCGGAGTACGCGCTGTCGCATCGAACCATCCGATCCAGGTACACGCTCCCGAGC
CTGCGCTCCAGTCTGCACGCGACCGTGAATCGCGCGTTCCAGTGTCCGCACCCGCTCCAGCAACTCCCGATTCGACTGCCGCAGAGCAGTCGCGGTGTGC
GACGCCTCCGACGACTGTTGCAGGGCGATGTCAATATCCCGCTGAGAGTCCCAGAACTGGTTCACCAGTGTGTCATCGTCTTGGCCAACCAGGACGCGAA
CGTTATCAGCGCGACGGTCCACCTCCCATTGTTGACGCTGCTGGTGATCTCCGCTGGATTGTCGATCATATCGTGAGTCATGAAGATCCTCCACGAGCAT
TGGCTCGCGGGCGTGCCGGCCGGACGATTCCGACCACTCGCCGTTATAGAGTCCGCTGGCTTGGCTTCTCCCCGAAGGACGATACGTGGGAGCTCCGCGC
CAATCTCCTCCGGGACGTTCCGGATGTGGTTCAGGAGTACGAGACGAAGATTGCCGTGGCCAATAACCAGTCCGATACGTACGCGAGCGCGAACGAGATC
GTCGCCCACGCGCTGGAGAACAAGTTCGGCGACGCGAGCGATCGCGTGAACGTGAACGCGACCGAGATCCAAGCTCG