Description :
From Genome Similarity Track
Location :
Scaffold_1621:834- 2222
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1621-snap-gene-0.1Chaperonin

Sequence
1388 bases(100 bases per row)
GTATGGTTGGTGGAATGATTTCGTTCATTCGCCGCAACTGTTGGGGATGTTGTCCCTGTGAAGGTGCGAAGACAGCGGTCTCAAGATGGCAAGGTCGTCA
GATATTATTCCGCCGTAGACTTCACGATGTTGCCTGCGTACTTTACGTGGTCGAAGCTGCATGCAGAGATGCAGATTTACGTACAGGACAATGAGCTGGA
CGTTCGAGAGCCAGAGGAATCGACGATGCGAAAGCTGCTCAAGGACAAGTGCCCTACCATCAAGATTCGCTCCCCAAGGAGCAATGTATGCGCTGTTTGC
AGCATCTACTACTCGCAGATGCGAAGCTCCGTCCCAACAACCGACCTGACCGAGAATTTCGGCAAGCACACAGCAGAAGCACGCGTATGCGGTAAGTGGT
TTCGCGGATATTAGCATCATTTTCGGATACTGACATCATTTGGTTTAAACGGACTGTAGTGTCGAGTATGAACGAGACCTGCAAATGGCAGACACCGATC
ATGCAGTGATCATCATGGATTTCAGTCAAAATCTGACTCTACCAAGCGTTTCGAGCACTCCATCTCAATGGTATTTCATGTCGTTGTGGGCTGTCAACGT
CTTCGGTGTTTACTATGCCAACAAGAGCTTGCAGTACAACTACGTGTACGACGAGCGCATAGAGGGGAAAGGTGCAAATGAAGTGGTATCGATGCTGCAG
CATTTTTTCGACACCGTTTTGATTCCAGAAGAATACTCGCACCTGACCGTGTATGCAGACAACTGCTCCGGTCAAAACAAGAATAACTTTGTCCTAAAGT
TTCTGCTGGCAATGGCACAAATGGGTCGCTTCAAAGAGATTTCGCTCAAGTTCTTCATAAAGGGCCATACAAAAAACGCGGTTGACCGCGGATTTGGACA
CATACGCAAGAAATTTGCACGCATCGATGTGTGGACGATGGCGCAGCTAGTTGACGTTGTGAGATCCGCATCCAAGGCTAATGTGGCAGTGCTCATCGAT
CGAGACACCCCCGTTTTTTTCAAAACCTACAAGGATATTCTCAGCGAGGCCTACAAGGATATCAAGGGTGTCCGAGCTTATCAGCTTTTCTCAATGAAAA
ACGCAAATCCTGGAACTCTCTTCTGCCAAGTAGCGCCAGATGACGTTGCCAGTGAGTTTAATCTTCGCAGAAGCTACGACGGAGTTTTCACCAGCGCGGA
GAAACTCGAGGTTATGTTTGGCGAGCACGTTGAAATGCTGCCACCACCACCACCCAATGCTGAGAAGATCGCGCAAATGCACGAAAAAGTACGTCCCTAC
GTTCCGGCAGAATTCCAAGGCGACTTACTGTATGCATCTCCGTCGGTCGAGCAACTTGAAGCCGCGAAAATAATCAAGCAAGCTCGTT