Description :
From Genome Similarity Track
Location :
contig_108:83376- 84903
Transcript NameFunction/comments
g13669.t1hypothetical protein

Sequence
1527 bases(100 bases per row)
ATTGCCACCGGTGCCAACTGTGCCACTGCCAACCGACAGCGAGATCGCGCACCAGTGCCTCCACTGGTCGACGCACCCGTCGACAAAGAGATCGAGCCAC
TCGACCGGAAGACGTAGGTCCAGACGCTACCGTGATAGCACCGCTGGAGCTTGTCGCCGCGAGGCCATCGCCAGTGTTCAGCGTGATAGATCCACTGATG
CCGCTCGATGCTTTGCCGCTCGCGAACGTCAATGCGCCGCCAGTACTGCCACCACCGCCACCGAGAGCACCACCAGTTCCCGTGCTGGTACCGCCCGTGA
TCGACACAGCGCCGCCAGCACTGGCCGCACTGCTCGTCAAGCCGCTCGAGATCGAGACCGCACACCAACACCAGCCGTGCCGCTGCTATCTCCAGCGCTC
ACAGTGACTTGTCCACTGGCACCGCCAGAGCTTGTTCCTGACACAACTCGCACTGAACCCGACGCGCCACTAGTAGTGCTACCGGAACTCACCGTCACCA
GGCCAGACGAACCACCGGTCGCTGACCGCAACGTCACCTGGCCACTGGTCGACAGAGACGCCGACGCCGAACCACTCGTGATGTCAACCAATCCACCGAC
ACTGCTAGCAGCGGTAGTCCCACCTGCGGCGACGTTTACATTGCCACCGGTGCCAACTGTGCCACTGCCAACGACAGCGAGATCGCGCCACCAGTGCCTC
CACTGGTCGACGCACCCGTCGACAAAGAGATCGAGCCACTCGACCCGGAAGACGTAGGTCCAGACGTACCGTGATGCACCGCTGGAGCTTGTCGCCGCGA
GGCCATCGCCAGTGTTCAGCGTGATAGATCCACTGATGCCGCTCGATGCTTTGCCGCTCGCGAACGTCAATGCGCCGCCAGTACTGCCGCCACCGCCACC
GAGGCCAGTTCCCGTGCTGCCGCCGGTACCGCCCGTGATCGACACAGCGCCGCCAGCACTGGCCGCACTGCTCGTCAAGCCGCTCGAGATCGAGACCGCC
ACCAACACCAGCCGTGCCGCTGCTATCTCCAGCGCTCACAGTGACTTGTCCACTGGCACCGCCAGAGCTTGTTCTGACACAACTCGCACTGAACCCGACG
CGCCACTAGTAGTGCTACCGGAACTCACCGTCACCAGGCCAGACGAACCACCGGTCGCTGACCGCAACGTCACCTGGCCACTGGTCGACAGAGACGCCGA
CGCCGAACCACTCGTGATGTCAACCAATCCACCGACACTGCTAGCAGCGGTAGTCCCACCTGCGGCGACGTTTACATTGCCACCGGTGCCAACTGTGCCA
CTGCCAACCGACAGCGAGATCGCGCCACCAGTGCCTCCACTGGTCGACGCACCGTCGACAAAGAGATCGAGCCACTCGACCCGGAACGTAGGTCCAGACG
CTACCGTGATAGCACCGCTGGAGCTTGTCGCCGCGAGGCCATCGCCAGTGTTCAGCGTGATAGATCCACTGATGCCGCTCGATGCTTTGCGCTCGCGAAC
GTCAATGCGCCGCCAGTACTGCCGCCA