Description :
From Genome Similarity Track
Location :
Scaffold_53:83343- 84972
Transcript NameFunction/comments
Phymu_g2843hypothetical protein PHYSODRAFT_286376

Sequence
1629 bases(100 bases per row)
GTACAGGTAGCCCTCCAGAGCGTTACGGCCATCAATGCGgtccttgaccttcttgtcctcgtcggCAAACTCAGCAGCCTCCTGGACCATGCggtcgatc
tcctcctggGACAGACGACCCTTCTCGGCAGTGATCGTGATCGTCTCAGCCTTGCCCGTGCCCTTGTCCTCGGCGGACACCTGCAGGATGCCGTTGGCGT
CGATCTCGAATGTCACTTCAATCTGGGGCACACCACGCGGGGCGGGGGGTAGGCCAGTAAGCTCGAACTTACCCAGAAGACGGTTGTCCTTGGTCATAGC
ACGCTCACCCTCGAACACCTGGATCAGCACAGCGGGCTGGTTGTCCTGGTACGTGGAGAAAGTCTGCGACTTCTTGGTCGGGATCACAGTGTTACGGTTG
ATCAGCTTGGTCATGACGCCGCCCACAGTCTCAATACCCTGGGACAGAGGCACCACGTCAATCAGAAGCACGTCCTTGGTCAGGTCGTCCTGCTCACCGC
CCAAGATACCGCcctgcactgcagcgccgtaAGCGACGGCCTCATCGGGGTTCACACCACGCGAGGGCTCCTTGCCGTTGAAGTAGTCCTtgatcagctg
ctgcaccttaGGGATACGGGTAGAACCGCCCACCAGCACAatctcgtccacctccgACTTCTTGAGGTCGGCGTCCTTCATCACCTTCTCGACGGGGCCG
AGGGTCTTCTTGAACAGGTCctcgttgagcttctcgaaaCGGGCACGGCTCAGAGACTCCGTGAAGTCCTCACCGTCCAGAAGAGACTCAATCTCAAGAC
GAGCCTGGGCCTGGGCCGACAGGGCACGCTTAACACGCTCAGCCTCACgacggagcttctgcagggCACGCTTGTCCGACGCGACGTCGaggttcttgtc
cttcttccacttcttgaTGAAGTACTGCATGATACGCTGGTCAAAGTCCTCACCGCCCAAGTGGGTGTCACCGTTGGTGGCCAGGACCTCGAACACACCG
CCATcaatggccagcagcgtcacaTCAAAAGTACCGCCGCCCAGGTCGAAgaccagcacgttcttctcgcccTGTGCCTTCTTGTCAATACCGTAggcaa
tggcagcagccgTGGGCTCGTTAATGATACGCTGCACAGTGAGACCGGCAATGGTACCGGCGTCCTTGGTAGCCTGACGCTGGGCGTCGTTGAAGTAGGC
GGGCACCGTCACGACGGCGTCAAACACTTCACGGCCAATGTAGCCCTCCGAGATCTGTTTCATCTTGGTGAGCACCATAGCCGACACTTCCTCGGGGGCG
AACTGGCGCTTCTCGCCCTTGACATCCACCTCGATGAAAGGCTTGCCTTCCTTGTTGATGATCTCGtacggcagcagcttcttgtcggcCTGCACCGACT
TGTCACTGTACTTGCGGCCAATGAGACGCTTGACATCGAACAACGTCTTCTCCGGGTTGATCGTGGCCTGGTTCTTGGCTCCGTCACCAATCAGACGCTC
GTCGTTCGAGTCCCAGGCGACGTACGAGGGCGTGATACGGTTTCCCTggtcgttggcgatgatctccaccttctgGTCCTTGTAAATGCCCACGCACGAG
TAGGTCGTGCCCAGGTCAATGCCGATCAC