Description :
From Genome Similarity Track
Location :
Scaffold_884:8334- 12353
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_884-snap-gene-0.11Metalloprotease family M48X
Pytar_ATCC12531maker-par_contig_884-fgenesh-gene-0.4Fumarylacetoacetate (FAA) hydrolase

Sequence
4019 bases(100 bases per row)
CGTTGTCTATGCTCTATTCTATCTATCTACAACGTGGTCGATCACATCTTCATGCAGTAGAGGCAGCTCGAGTGACTGTCGTGGACATTTCGATCCACTG
TGTGGTGGCCGTGGGCAGCTGCCGTTCCCTGCGCAATGAGCTTGAGGTGGTGAATGCGAGAGGTCAAGAATGGGTGAGCCGTGTCGCCGAGGTAGTTGCC
TTCCTTTGTAATCATGCGCGTATTCATGAGCGATCGCAGCTCACAGTTGTGGGAGAGTTTGCGCTGGAAGCAGTGGATGCCGCCGTGGACGAAGCCGCTC
TCGGCCGCAATGTGGTCGGCCTCGTGCTCAAGCCGCCACGAAACCAGCATGTTGCCAGCCACCAAGCCGACACAACTGACAATTGACGCGACGAATGTGT
TGGGGATCCGCTTGATGGCGGAGCAGCTTGCAATAACCGACAGCGGCAGAAACGTGCCGGAGATGATCGAGTGGTTGCGCGCGATGTGGGCGGCCTCGTG
GGCGAGCACAAAGTCGACTTCTTCCTTGCTGGGGATCTGGCCCGTGAACTTGCGGCGCAGCTCATCGGTCGCAAAGAAGGCGTCGTACAGATCGAGGGGG
AGCACGATACACGCGCCGCGGAATCCGATGGTCGCGTTGGACCCGATCGACGCGCCGGACGTTTCCTCGCCGACCCGGACCGACAAGTTTTCCGGATTTT
TGACGCCAATGCGGGCCGCGATCTTGCGGACATTGACTGCGAATGGGTCGCTACGCTCGAGCGGGACCGAATCGGAGCCCTGCGCGAGGCTCAGTGACAA
GTCGCTCGTCGGCGCGGCCAGCGGGAGGCTTGAGAACGCGTACATGGCGAGCGCCGATGTGCCGACGAAGCGTCGTGTGATGGCGGCGGTGGACATGATG
GCGATGATGCGCTTTTTGGCAAGTGCCCATGCTGCCGACATGGAGGAGGTTGGTGCCGCACACATGTGGTCGTCGTGGCGCACGTCTTTGCAGTACACGC
CGCTTATCTTTGTCGTCCACTATGCCAAATCAGTGGTGGGTGACTTCGATCAGACTCGCCCACTACTATCTCACGACGACGTGGAGACCTTCCCGAGCGT
GTCTCTTGGGACGGTGCTGGAGACACGAAGCCCCGCGGGTGATGAGATGGCTTCCTTCTTGTGACTTGCTCGATTCGCTGCGTTGCTATGGCACCGAGAT
CAGTACACGGTACAGTATCACCCTGACCCAATATAACTCGAGGTTCGAGTGCCGAAGGCGTTCTGAAGAGGGGCCGCCTCCACGCGTGAGATTCGATTGT
GGGGCGGAGAATCCAATGGGGTGAAATGGCGCAGCGAGTGGAGTCGGCATGGACCACCCACGTACGCAGAAGAACGAGGGGACGTCGCCAGCGTCGACGG
GATCACTGACGTAGGACCATCACTCTATGGTGTACCTGCTCGACGTGACGCCATCAGCCAATTAAATCCAGAGTATCCGGACCAACCGACTATTTTGACA
CCTGTGTAAAGTGTTATTTTGACACTTTTGTACCACAAATAGTGTCAAGTTCTGGCCGCGAGCGTTAAACGGTCAAAAACGTGCACCTCGGAAGCGAAGG
AAGGTTTTGGCCGTTTAACGCAGACTGTCTCATATCGATACTGTACGGTGCAGAACAGTAGAAGAAGAAACAACTTACACTCAGTTATTTTGGGTCACAC
GGCATCATAAATCTGGGTAGCAGTGAATCGTAGCTGGAAAACCCAAAGCTTAGAACGATAGCGTGTTCTCACAACGCGGACGCGCCCACTACGGGGTTCA
CGAGCTTGCCGATGCCCTCGATGGAGATTTCCATGACGTCTCCAGGCGCTAGGAACACTGGCGGGCTGCGCGTGAAGCCCACACCCTAATCAAGGACAGG
TTAGTCTACGTATTGAACATGCGCAAGGTTAAAAGTACTCGCTTACCTCGGGCGTGCCCGTGATGATGAGCGTGCCACGCGGCAGCGTCATATCCTGTGA
GAGCTGGCTAATCAGCTCGGCGACTGGGAAAATCATGTCGCCCGTCGACGACTTCTGCATGAGTTTGCCGTTCAAGACGGTCGAGATCTCGAGTTTCTGT
GGGTCTGGGATGATTTCGGGCGTGACTAGCACGGGCCCGATCGGACAGAATGTATCAAAGCTTTTGGAACGGCACCACTGGCCACCACCGCGCTTGCCCT
GCCAGCGACGCGCCGAAATGTCGTTCGCGCACGTGTAGCCACCCACATACTTGAGCGCGTCTTGGACCGAGACGTTCTTGCATGTCTCCTTGAGCACGAC
CGCGAGCTCGCATTCATAGTCGAGTTCCGGAGGATCGGATGCGATGCGTGGGATCACGACGGGGTCATTCGGGTGCTGAATCGTGTTGAGCCCCTTGGTG
AAAAGCACGGGCGTCTGCGGCTCGGGCATGTTGGTCTCCTTGGCGTGCTTGCGGTAATTGAGGCCGATACAGAGAATCTGCGACGGCACGACAGGCGCGA
GCAGCTTCTTGATCGTCGCCTGCTCGCCCGTGAACTGGAGACTCCCCAGTGGGTCATTGTTCTCAACGAGGCGGACGGTGGCGCTGCCTTCTGCGACGCG
CTGCCCGCAACGTGTCGCGCCGGTCGTGTCGACAAAGCGGACGAGATGCGTCGCGCGGCCGCTGCTCTTCGTGCTGTAACCCATGGTGGCGCTGTGGAGC
GATTGAGCCGCTGAGACGCGTGGAGATGAAAGCAGGGAGCGAGCCCGACGCCTCACAAGAACCACCATGGACGGATCTTTGTCGGATGCTGGCATCTCGC
ACAGAGAAAGGGATCCACTTGGTTATAGTGTGGACCACCTGACACACGGACTATTTGGGGTGGACAACATCAGAAACATATATCGTAGCCATATCATATT
CGACAGGTTTTCCCCTTCAGATCACTGGGAACGACATGTCGGTGAGCATGCCGCAAGTGCCAGTGGAGGCCGCACCACGTCGAAGCCGCACATACCCGTT
CTCACCCCAGCGCGTTCCCCACGAGTTTTTAATCTTGATGGACGTGGCGTCATAGCCGATTGCGATCACTGCGTGGTCGACGCGCCCGTTCGGACAGGAC
GTCACAACGCCGCTCTTGTACTGCTTCCAAACGGCGTTAGCGGCGTGCACGGCGATCACCACGGGCTGCTTGTTGAGCGCTGTGACAAGACCAGTCTCGC
CAGTCACGCGTGTGATACCCTTCATGCCCACATGCGTCTTTTGGCACGTGTTGCTGCACGCCGGTGCTCGACCACCANNNNNNNNNNNNTACGGGTACGC
GGCGCTCGTGCAGAGACCTGTCTGCTGGATATATCTCAGGGCCCCGCCGATCGTGCCGCCGCCACAACCGGCATTCGTGCGGTCGCAACTTGTCAGCTGC
TGCTCAGAGTACTTGTTGGCTCTGCCACCAAGCGCAAGGCATTGCACCGTCTCCACGACGCCGACCGTTGCGAACGCCCAGCACGAGCCGCATTGGCCCT
GTTGTTGCACCGGCGTGTTGCAGGCACTGTTGGTCCAATCACTGCTCACTTGAAGACGGCGGGTGCTTTTGCTGAAGAGCTTGCTCAATGATGATGTGAG
CGACGAAAAGTCGAGGTTCTTGAGAAAGCTCGACGGGTCCAGGGCGCCGGCTGATGGTGTACTCCCCCCGCTGCTACTGTCCGAGTCGTCGCCGCCGGAG
CCCTTGGTGAGCTTGCTCAGAGACGATGTGATTGACGAGAAATCAAGGTTCTTGAGAAGCTCACCCATTGAAGAAGATGTACTTTCTGCGCTATCGGCGT
CACGGGCAACGCCAGTGTCTTCCACATCGGCATCGTCGCCGCTACGAAGTGCAGGAGTGTCGGTAGTGATGTACGAGTTCCGCACGTACTTTGCAAACTC
TTCCTCAGTCAGGAGCGAGAACGGCGTGTCGGTCGTGAACTGGGCGTCCGGTTGCTCTTTCTCAAGCTTACTGACAAGTTGTTTGGTCATGAAGAACCGC
TGCTTGCGGTCCTCGGCGA