Description :
From Genome Similarity Track
Location :
Scaffold_539:8332- 10712
Sequence
2380 bases(100 bases per row)
CGGATCCTTTCTACCCGGCGGTGAAGAAGTATGGAGACGTTGTCTCGAAAGACCCTCCGACGGGCCTGCCTCCGGATCGAGGTGTGTGTCATGAGATTGA
CCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTATTCCGCGCATTGCACAAGGCA
GGGATGGTGCGTGAGAGTAAGTCTCCGCACTTGATACCCATGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATCGTTCATGCTTTTAACAAGTTAA
ATGCGGCCACTATCCCGGCGTAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGTGCCCTCGACTTGGTCTA
TGGTTACTACCAATTGCTCATGAGAGCGAGTGACGCTCCGCTAATAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTCGTGCCCCAGGGG
CTGTGGAGCGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCTCCACCTGGCGTACGCTAAAACGTATGTTGACCATATATTTGTCCATA
GTCGTGCCGAGCACGGAACGTTAGACGTGGAAAATCACATTGACCACTTGCGAGCAGTGCTCGAGTGCAAGCGCACTAAAGGTTGTATTCCAACTTGGAC
AAGTGCGTCTTTGGTGCGGGGGAGATACCATTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACT
GGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTAGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATT
ATTAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATACTT
GCGCTACCGGACCCGGATAGTCCGCTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAAC
GCGTGATTGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCGCTAGTCAAATT
CAGGGTACATCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACAAACTACGCCACAGTCGCCTTATCTCTCTCAGAGAATGGCAAGATGGCTTT
TCTTCTTTGCCGAGTATAACTTCGAGGTGAGATACAAACCGGGGCGGCTTAGTGTAGTGGCCGATGCGCTCTCGCGCAAGCCGGACTACGAGTTAGCTCA
TGTCACGATGGTGACGGCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCATAAGATGGCACGTGCGTAGCGATGCTACGGGCTCTTGGGAGCGACGAG
TATAATGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGTCTTCTGTACTACAGCACCGACGCTGAGG
ATAACCCTCGTGAAGGCGTTCCTCATGATGTAGATCTCAAGTATCGAATCCTCTATGAGGTCCATGATACGCCCGTGGGCGGGCACTTAGGTCGGAAGAA
GACCCATGACTCGGTGGGCTCGATGTACTGGTGGCCCAAGATGGATCAGTGGGTCGGCACCTATGTATGCACGTGTGAGACGTGTCAACGGACAAAGCCC
GCGCCGAGCACGGCAGCGCAATTCGCGAGTTTGCCTGTCCCCAAGGGATATTGGCAGTCCATGAGTATAAAGTTTGGGTTTGGCCTTCCCAAGGATAAGG
CGGGAAACACGGGTATAGTGGTCTTTGTAGACCAATTGAGCAAGATGAATCATTTAGCGGTGGTGCCGGACACCATGGATGGTGAATGTACAGCTTTGCC
GTTTTAGCCTGAGGCTTTCGCCAACATGGCTTGCCAGAGGCATTTGGCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTATTCAGAG
TGCTTGGCACTCTTTTGGACATGTCCACAGCGGCCCATCCGCAGACCGACGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGTGT
ATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATACTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTAT
GTAAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGTCTCAGAGCTTGATGGGAGAGGGACAGCCGG