Description :
From Genome Similarity Track
Location :
Scaffold_33:83302- 86298
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13453G-protein alpha subunit 1
Phypa_INRA-310PPTG_13454hypothetical protein
Phypa_INRA-310PPTG_13455signal recognition particle receptor subunit alpha

Sequence
2996 bases(100 bases per row)
GCTGCAATAGCGCCGCAAGGCCAAGGCCACCGACGATGTTAGTGCCAGCATTAAGTCCATGATGCCAGCATTAAGTCCATGATATTGATGTGTATGTAAT
GCAGGCAAGACCAAGAGGCTAAATGGGAGAAGGGTCAATGTATATAAATTGTTCTACGCAGTCCACCTCTTTCTACTACCTACGAGCCGGCGAAGGTGGG
GAAGCGCTGGGGGTATGCTAGGCTGGCGCTTAATAGGCTTATCTCGCTTCGCTTGGCACACGCTCCTCGACCTCAAGGCGTGTCGTCCGTCAGTTATCTG
GTCGACGTGCGTTTTCCGTTGTCGTACAAGTCATTGCGCCTGCCTACATGAAGCCGGAGCCCTTGATATTCTGCTTTAAAATAATGTCTTTGCAGGCGTT
GAACACGACTTGGACGTTCTGCGAGTCGGTAGCGCACGTCACGTGGTGGTAAATTTCCTTCTCGGGCTGGCGGTTCATCTCCATGAACTTTCCAAGGAAA
TACTGCACTCCCAGCTCGTAGTCGCCAATGCCACCGGGGAAGTCCTTGAACACCTCCACCGACTTGGGGTCCACCTTCTTGATCTTGTCCTGGAACAAAT
CCTTCTTGTTAAGGAACAGGATCATAGCAGAGTTCAGGAAGAACTTGTTATTGATGATCTCGTCGAACAAAGTGATGGCCTCGATCATACGGTTTGTGGA
CGCATCCTCGTACAAAGACTGATCGTACTCACTCAGCGCTGCCACGAAAATCACTGCCGTCACGTCCTCGAAGCAGTGGATCCACTTCTTACGTTCGTTA
CGCTGTCCACCGACATCGTACATGACGAAGGTAGCGCCATCGATCTGGTACCGTTCTTCTACGATACCGGATGTACGCACACGTGCGTACAACATATCCT
GTTGCGTCGCTGCGTAGTCATCGCGCATGATGCGGTCAAGGTCATTGAAGTAATACTTGACTGACTCGATGATCTGGAACTCAGCTCGTCGGTTCCACGT
AGCCACAATGCCAGGGTCTGTCCAAAGGTTCTTGATCTTCTGTCCTATGACCGGGTTCACTTCTGCCTCATCACTCAGCGTCCGAATATCCTCGAAATCT
TGTACGCACACAACTTCGCCCTTCAGTTTCATTTCCGTACACTGCTCGATCAGCATCTTCATGGACGTCACCACGTTGTTATAGATAATGGGTGTGCAAT
GGCGCTTCTCCTCTTCGGTTAGAGCTGCACCATACAAAATCTATCATAGAAGAAGCAAAACCAGAGTTAGTTATAGAGTTTTAACAACTTTTGAGCACTT
TCATCATACACAGTCGGCGCACCTTCATCTGTTTGAAGACCGTACTCTTGCCTGACTCGCCTGCACCTAGCAACAGCAGCTTGACCTTCTCCTGCTCCAC
GCGGTGAGCCTCTTCGTTCTTGGCTTCAATTTCGCGGGACTTAGCCATCGCCTGCCGATCGGAATCGCTCATCTGGGAAGCACAGAGCCCCATGTTGACT
CTGTGTTGCCTTTGCTTACTGTCGAGGGCTACCGAAGCGCTACTGCTTCGACGGTTGCGAACGATGTGGGGCAGGGCGCAAGCGAGCAGGGGCTGGCGGC
TCTGTTTCTGTTGCGCGCGGGGGCTCTACTGTCGGAGTGGGAAGCTGCACACGTTTCGCCAAAATGGTAGCGGAAGTTTAAAAATGAAACCCCGCCACCT
CCTTTATCACCAGTCTTCTTCTTCACAGAAATAAACTCCGTCCCTGCACAAATGCAACGACGCCACCTCTCGGTCTCGTCGCTATTAATACAGGTGTCTA
GGCAACGCCCAATTGGCTCGAACATCAGCTCTGGGCATCTACAGACTCGAGGCTGAGCAAGAGCACAGAAACCACTACGTGGCATGTCCATGATTAGCTT
CGATGACGACTTGTTTCACAGATGCCCTCATTTAGCTACGTCGTCGGGTCTCGTGGCTCAGGTAGTGTCGAGCTCTGAGCCTCCAAACAACCGAATGGGT
CGAGCAGTCCATTTGCTGGCAATCACTCTAGAGCTTGACCTTCAATCTCCCTCGCAGGAGTGACTTACAGATTGTAGCCATTTTGATGGCGTTTTTTTTT
GCGCCATATAGTGATGGGCGGTCATGCAAAGCCGCGTCATCCCCAAAAACAAACATGATTGGATGAAATGCGTTATCAAGTCCACATGACCACCATGGTC
AAAGCGGACGCTCACATACCGATCCGCCTTGTGCACGTCAACTAGATCCTATCGCTCCATGTCACCGAACAAAGTCGACCAAAACACTATCAAGGAGTGG
CACTTCCACACGTGCTTCTACCACACCAACGAGTGCTCCAGGAAGGAGGCGCAAGCGCTACGAGATGCGCTTGTGGACCAAGTGACGGCTAACCCCAAGA
ACTTCATCGCTGTGTGCAATGGCATGACGACCAAGGAGCTCCCAGGTCTGGAGGGCAAGCCACCTCCGATGAACCTCGAACCTGTGGGTCCGCACGTCAG
TGGCAGCTTCGAGACGTGGGTACCTGCTGAGTCCTTCGCCCAGGTGTTGTCGTGGTTCACGCTACACCGGGGGTCGCTCAGCGTTCTGGTGCACCCGCTA
ACGCGCTACGAGCGAGAAGACCACACGACTCATGCCATGTGGCTCGGAACGCCATGGGTAATCGATTTGGATGCTCTTCGCGTGGACTTGGTCACGCCCC
CGCTTCAATACCCAGAGCTTGGATACGGATACAGCGCCAGTACGAACGAACATTGAGAAGATACTGGAGAATCACGTCGAGTGCTATTTGAAGCGTTAGG
AAAAGTAGTCGTCCTCACTATGAAGAATGGAATTGACGTGAGATCCGTTTGGTCGAGCAGAGCGTCAAATATCCTTACTGAAGGAGGTGACGCAGCACAG
TTCGCACGTTTAGCTTCTTCAGGTGCGTGTACTTCTGGCCCGTGCCGACGAACATGATCGGCTGGCCAGTCTTGTAAACCATCGACACCGCAGCAC