Description :
From Genome Similarity Track
Location :
Scaffold_527:8330- 12759
Transcript NameFunction/comments
g13669.t1XP_008909379.1 hypothetical protein PPTG_14144 [Phytophthora parasitica INRA-310
g13670.t1hypothetical protein

Sequence
4429 bases(100 bases per row)
CATCCGTGGGGGCTCCTGGCCGCCGTCTTGCGCTCCCCCAGTCGCCTACTGGACGGCGTCACGGCTTCCCACCATCGCTACATGGACCGAGCCGCCGCCG
CAGTGACGCAGAACCCGGTGTTGTTCCCAAACGGCTTTTTCTCTGATGGTTGGGGCGATTTGAACACCCCGAGACGCATTCGGGAGCTGCTACAGAGTCG
ACGTATGGGTGACGTCGTGACGCTCAAGGACGGAGAACCCAATTGGGGACGAGTGAGGCATTTATCGGTGGCCAAAGTGGCGCTCAGAGAAGGAAAATTC
AGGAGCACGTTGGCCAATGCACAGCACTTGCTGCCGGAGCAGAGTCTGGACGCCTTCTGTGAACTGGTGACCCCGTTGGAATGGGAACAAGAGGACCAGG
GGATTCCTCGCGGAAAGGACCGACCTCTTGTTGGTAAGTGTGCGGTAGAGTGTGTACATGGAAAATGGAGAGTAATGGCGTGGTGTGGCGGTAGTGCTGC
TGCCTGGAACGGGTGAACATGGGTTCTTGCATCGGAGGTCGTCTATTGCGATCCCTCTGGCGAAGCAGGGAGTTGCGACGTTGGTACGCCAAGATATGGA
TTTGATGACTTCTTGAACTAGTCCTGGTGCTTACGTGTGCATTCGTGCTCTCGTATTTAGATCTTGGAAGGACCTTTTTACGGGAAGCGCAAGCCACCTC
AGCAAAAAGGATCCAAGCTGCGAAGGTACAGCAGTACCTGAGTGTGTAATTCGGAACGTCCGTTTGATGTTCCTATTCATGCTGTGTTTGCAGGGTAAGC
GATCTGCCGATCCTAGGGCAAGCTACTATCGAGGAGGCCAAGTCACTGCTGGAACACTTCCGTGATTGCCATGGGTTCTCGCAACTGGTGGTGGCAGGTA
GCAGCATGGGCGGACTTCATGCTGCGATGGTGGCGTCAGTGTTTCCTGGAGACGTTGGAGCGACGGCATGGCTGGCCCCACCGTCAGCTGCTCCCGTATT
TGCCGACGGACTGCTCTCAGGTTCCTGCAACTGGCGCTCACTTTACAAAAAGCACGAGTTGCAGATGCTGGACAAAATGCTAATTGGGCATGCAGCTGCC
GAGTCCTACGAAAAGCTGGCAAACACTGCAGCCGATGCCCAGGAAGAGGGAGCGGAGGCTACCGGTAGCGAGGACGAGCTAGATCCAGTTGACGAGGCCA
AGAAGCGTATGAGACTGTTCCTCTCGATCACAGATATCGACAATTTTCTGCCGCCTCGACGCTCGGATGCCGTTGTGTTTGTCTACGGCACCGAAGACGA
GTACATTGGCTTCACTGAACCCCAGTGGGCGGTACGTTGTGCCAAGCCATCGATCAATGTTGCTGTATGAAGCATCTAACTTCCTAACTGGTGCCTGTGT
TTGTCTTTCAGCGCATGCGCGAACAATGGAAGCCGGCGCACTTCAGAACTATCAAGACGGGCCACGTCAGCGGGATTTTACTGGAGCAGGAAGCCTACCG
CAAAACAATTTTGGAGGTTGTCGACCTTTTGAAGGAGCGAGGTGAAGCAGCTGAGTCCTCGTCAGATGCTGCTGTTGCCTAAGGGGCCAATGACCTTCAG
CAAGAAACGACCAACTAATATTTAGCGTTAGCAGCAGTGACTTAACGACAGGTCTACTGCAGTGCTAGTAAGCTAGACCAAAGCACATAACTGCGACGGA
GATCTTTGAACAAACTTGATGTCTCTAATGTGCACGGATCACTCGTGAAGACAGCAAACGATGATGTCCTGGTACGTACTCATGACGGTACGCAGTTCAC
CACGTGAGAGGTTCTCGCGCCACATGATCTCTTCAATGTGGTGCTCACCGTGGAAGTACACACACAGCCGCTTGAACAGCGTGAAAACAGGGTTGGGCTT
GGCAATCTTGGCCAGATACGCGCGCTCCTGGTCTGTGAACAGCAATTGACTAGCCACACTCATTACCTGTGCCATCGGTATCGTGCTGCCTCCGCGTCCT
TCTGCTGCAGAATTCTCATTGGAGGGTTCCAACGGTGCTGCCGGCGGTGATGGCAGCGCCATGGCAGCTGGATTCATGGGTGGTGTTTGTGCGATCGGAA
AACTACCGGGGACGCTTGTGTTCGTAGCGCTGCTATTGACTCTCTGGCGTCGCAGGCTGGATGCCATTAGTGCAGGCGACGAGCTTCCAACCGAAGATGC
ACCATTCCCGACCTCCGCAGCGTAGTCTCCATCGGACGGGATCATAAAATAAATGTAGCGGTGGAGCTGCACGATGAAGCGTTGCTGCAGCAACCAGATA
AGCATGTGGATGTACTCTGTCTTCTTGGCCGTGGACAAAGTCTTCATATACTCGCCAATACGACGAGACCCCGAGAACGTTGAGAGCACTTCGCCCAATT
CGTACGGAGCAAACTTGCGCCGAAACTCCTGAGCAAGCGGCGACGTTATATGCAGATCAGCCTTCGCATTGACCTGGTAAATATTGTACAGGGTGATCGC
GTCCACAATGCGACCAAATCCCCAGTAGACAAGATGTGCGGCCAATCGGAAGACCTGGTGAATCGGCACTCCAGTCTCCAGGGCCAAATCCTGAAAGCTT
TTGAGCGGATTCACAGCTTCCACCAAGTCTCTCAGTTGACGCGCATGATCTGCCGGTAATTTGTTCAGAATGCTGTCCTTGTCCGCGAGCAGCAGTAACG
TATGGTACGGTCGTAAGCTCGCCATCCTTACCGTCACCGCATCCGTCAACGTCAGCGACAACTTGACCCACCCATTCAGCACCACGTGAGCAGCCCCAGA
CTCTTCCAGCCCATGAAACACCCGCTTCAGGTCATTGGCCAGCACACTCTTCCCCAACGAGACGTCAATCAACGTCTGTGGATCTACTTCCACGGTCGAC
GATCCATTCTCTCCGTCCTTCCTATGGAGATGATGGTGCATCAAACTCGATCCGGTCGTCGCAGCTCCCCCAGCGTTGCTCGTGATGCTGCTGCCGCTCG
TCGCACCGGCTGCCACCGCTGCACTCACACTATTTGCACTTGTCACCCCTGGAATTCCATTGCTGTTGTTGCCCGCGTTCCTCTCACTCTGAGCCAACTC
ATCTCTCAACTGCAGCAGCTCCCGCACCTCTTTTGACACGAAACCCACTCGAAGCTCTTCGTGCAAAAGTCCATTGGATAGCTGCGCCGCCACTGTGTGG
AAAGCCTGAGCACTGCTGCGTCTCCTGGCCAGAAGTTCCTCTTCATCTGCCTGTTGCAGAGGCAATAGTTGCGTGTCAAAAGTGGTGTCCAGGGGTCCCG
CCGTTCTCGCCATTTGTGGGGGCCTGTCTTCCAATGCAAAAATGACGTTGAACATGGTCGTCTCGTTCCCCGTTGTGGCAGTAGAGCCGTTCGTCGATTG
CTCTACTACTGTAGTGGACACTCCAGAAGCCGATGTTGAGCCATTTCCGCCATTTCCCGGGCCGTCCGCTGGTGCCACAGCCGGCAGCCGACGCGACACT
AACACAGGGTGACTCACGAAGCGCAGATCGTCCACCACGAGCTCGAAACTGGCGTTGCAGAGCGCATTCTTAGGCCGGAAGAGTTTGGCCAACAGAGGGG
CCGGCAGCGAGTGGAAACTGGACACGTTCTCGGACGGAGATGCTGGGTATCGGAACGCCAAATTGCAGCCCTTGCTGATGTCGTCCACGACCAGCGCAAC
GCCCAAGAGGCGGCAGCCACCGGCCACGCGGAAGCCCCAAGTGTTCATATGCTGGAGATCTTGAAAATGCGCTTATACCTAATTGACAGTTGAGTAGCAG
ATATAAACTGCTGGTAAAATGTAAAGCGTACATGACGCAATGCTGGTAAAGTGTATAGACAACTTCAACATAAAAAGATGGCTACATTTTACATTTTGAA
TGGTACACGTGGTAGTAGGTGTAGTATGAGGCGTGTGGGCTGGGGCTGGTTGGGGACGACGTCCTGGTCGCGAGTGCAGTAGGCAAGGCTTTGTGTGCAG
AGCGTCTGCAGCATGAGACGAGTGTTGCTAACGCTCTCTTTGGACGGGAAACAGGCGCTTTGCAGAACGACTTGGCCTCCGTTGGAAAGTTGGTGGCGGA
TTCGACGCAGGACCTCGTCTCGGTATGCTGCGTTAGTCACCACTTCGTCCACAGGCAGATCGATCAGCTGAAGCTCTTGCTCGAACTCGTTTTGTGGGGA
GACGGCTGCCTCCTCGTGTTCAACTTCCACTTCAGTGACCTTCTCACCGTGTGATTCCGCTGCGGTGGACTGCTGGTTCTGTGCCTTGCTTTTCGATAGC
TGGTCTCTCCACTGCGGTCCTCTCCGCAGCTCCAGGATTCTCTCTCGCTTTCGAATTGCGTTCGTTGTTTCGCGCGCTTCTTGGTCCCGAGCACGGGCTC
GATACGCGTGCTTCACCTGGCCGACAGTC