Description :
From Genome Similarity Track
Location :
Scaffold_1048:8330- 9416
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1048-fgenesh-gene-0.3Protein kinase

Sequence
1086 bases(100 bases per row)
GCACTTCATCCAGCGTCGGGCGACTCACGATGTCTGGGATGAGCATCCACTTAACGAGCGACGTGAACGCGGATGAGAACTGCTCTCCGTGCGAGCTCTT
CTGTGGGAAGCGCACGTTGCCGTTTAGGATCGCAAGATGGAGCACGCCTTCCTTGGCGTTCTCAAACGGCGAGTACGGCCCAAACGCCATCGCATACAGA
GTACACCCGAGCTGCCACACATCTGTGCGACCATCGATCACGCTGTTCGGGGTGTATCCGTTCGAAGTCCAGAGCTCGGGCGGTCGATACGGTGCGCTGC
TGAGGTTCTCGGCTTCCTCGCAGAGCGCGTTGTGATCCATGGCGTTCCAGATGTGCGTGCTGATCGGCGCGATCGAGCCAAAGTCCATGAGCATGGGCTG
CACGGGGTTGGTCGACGAGATGAGGACGTTGCCCGGTTTGAGGTCACGATGCGCAAAGCCCATGTCGTGCACCTGCTTCACGGCGTCGAGCAACTCGGAG
AAGAAGCGCAGGCACTCGCGCTCGGAGAACGGTGAGCAGCCTTCTGTCATCAATCAGTCAACAAGCGTCAACAACACATGTGCAAGAAAGATGTCATTAC
CATAGAGACCCAGCTGTACAATACGACCACTAGCATATTGGCTCATTACCTTTCTGGAACGCGTCTTCAAGCATCGTCTGCAGCGAGCCGTGCTGGCAGA
TGGGAAAGAGCATGAGCACTTCCTTGGTTCGCTGCGAGCCCATGTCGAGCCGCATCCGTCCGTCGCCGTTGCCAGTACCACCACCGCCACCGTGACCATT
GCTATGCGCGGGCTTGGTCTCCTCATCACTCACGCGCACCTCAGACTCGACAAGCGGTAGGATGTTGGCGTACTGCTGGCCCAGCCGCTTGTGCACCTGG
ATCTCCAGCAGCAGGCGCTCGAGCGTGTCGGCGTCGCGCACGCCGCGCACCCACTTGAGCGCGAAGTGGCGTTTGTCACTGCCGCGGCGCACCTCATAGA
CCGTGGAGGAGCCTCCTTCGCCCAGTGTGCCCAGGATCTTGTACGCGCCGCCGTTCACGCGCGCCACCGAGTTGCCCATGCTCTCT