Description :
From Genome Similarity Track
Location :
Scaffold_468:8328- 9829
Sequence
1501 bases(100 bases per row)
TCGACTTCATACTGGTTCGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TCAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTG
GCGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCTTAGT
CGGCTTGAAGTGGGTCTTCTACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGCCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGGACAATTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGCTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
ATAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTACAGACCAATCCAGTAGTAGTCG
GTCTTGACTCGGTGATAAGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGCAGTTATGAAGTATCTCGTCGACCATAGTTGACGGAATCA
CCAATCTCAATGAGAGTTTCGGTTCGCCGAGTTCGCCCAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAATACTTCTGC
GACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCACCTCTCAGGTACGCCTTCAGGTCGGTCCACCTGAGTTCTTCATCTTGTGCC
T