Description :
From Genome Similarity Track
Location :
Scaffold_26:83274- 87361
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009525candidate di-N-acetylchitobiase
Pytul_DAOMBR144PYU1_G009524Similar to UPF0470 protein C19orf51 homolog (Xenopus laevis)

Sequence
4087 bases(100 bases per row)
TAGTCCAGCGTGTCGGCGTTCCACATGCCCGCGCCAAGCAGCCCCAGCTCCCTCACGAGCTCGTACTTCAACCTCAGGCTCCTCGGGTCGTCGAACCAGA
TTTGCTGGACCGCTCCTGTATTTCCACGTCCAGAGCTGTTCCCAGGAGCTGCTGCGGATCCAGGCACCTCGACAAAGGGCGTCTGCGACATGGCGTCCCA
CTGCACTGCTAGCTGCTGCTCATCTACAACCTTCATGATCGCACCGAAATCCATCTGCTCACCAGCAGCGTCACTGCAAGGAGCGCCAAAGAATGGGACC
TAGAATGATCCCAGAAACTCGTTAGAGTCTACTTCTAATAACAACGCAAGCAATTGATTGAGAAATACGTACTGGACGCAGCCCGCAGACGGAAGCGACC
TCACTGTACTGCTCGCAAGTGTACTTGTAGCCATACCAGGGGACGCCGAGCACGAGCTTCTTTGGGTCGATCCCATATCCGAGAATGAACTCCTGAAGTC
CTTGCTTCACCAGCGCCAGGGGCGAATTCGCGGCCGCGATGCACTGATAATAGATCTGACTGCGCATGTCATACTGTATAACACACGAGTGAGAATAGGA
GATGCCACCTTGACACGTCCTTGCACCTGTACGCACCGACATCACAAAGAGGAAGTCCACCACATCTGCGAGCTCCTTCCATTGATAATATCGGCCATCA
ACTCCACGTGGCGCCCAAGACACGTCGAAAGTAATCTATAGGTACCCATAGATCGCAGCACGAAGCTTAGACACAGCGAGTAATTAGGTCATAAGCAATA
TGACAAAAAACCTGAGCTTGCTGGGTGAACGCATGCTGCTGCAGTTCTTGCCGCAGCTCCTTCACCAGTGCCGTCATGCACTTGGCGATCTCCCCATGCA
TCGCCTTCTCAGTATCGATATTGACACCATCGGCAAAATTCGTCACAATACGCGTGTATGTTTCCTATGCACACGCAACGGGCAAGAACAGCTACTTAGT
CAGCATTCTGAACAGCAAATGATGCGCATACAGGACGTACCTGGATCCACTGCGCTCTGACATTCGGGTCACATAGCTTGTCAACGTCGTCAAAATTGTG
CTTGATCACAACTTTCACGCCCTTGCTGTGCGCACGACAGAGCAGCTCCTTGTCTTCGTTCCACGCCACTGTCGTGAGCTACGCATGAACACACGCCCTG
TCAGTACTTGTTACGAAGATGGAAAAGAAAGACACCAGATCTACTACTCGCACCTGCTCCCAGTCGTAGCTCTTCCACTGATCCGTCGATGTCACGGAGA
ACGCAAACACCTCTTTCTTCTTTTTTTGCTGCTGCTGTGTGGCTATAGACTGCTGCACAGCATTCGCAACCACTGGCAGACAGAGTGAAATCTCCTTGGA
CGCGGTATGGTCAGCGTCGTCACGCCGCGTTTGCTGCACGCGGCATGGACACTCGAGCAGCACGCTGCGCTCAAACGCGCTGAGCGTGTGGATGGGGAAG
CCCTGCGGCGCGTACACGTGCGCGCGCGAGCGTCCGGACGGCGTCAGCAGTAACAGCAACAGCAAAAGCAACGCACTCGCGTGCATCTTCCTCCATTTCG
CCATTTTTGTGTTCTAAATCAGGGAATCAGATCCTGTCAAAAACATGGTGCTCTATGATTGGCTATATATTATGAAGAAATTTTGGCCAATCATGTATCG
GAACTGCTTGCGCCGTTTGGAATCCCATGGAAGGAGTGATTGTATGCCCAAAAAAGTATCTTTCTGCGTTTCTGTGTTTTTCAACAACAGCATTTTCGAG
AAGCTACATTGCCTCTTACACAAAGACAAGCGACAAGTTACTGCCTACGATGGCGACGACAGCGCAAAGCGTGCTCATGAGCCTCGGGATGGTCAACATG
TGGGGGTTCTCGCCTGCATTTGACATGCTGCACGGCGGTCCTGGTTTGAAGGCATTGACTGAAGCACCATCCAAGGCTCCATTGGCTGCTTCAGATGCTT
CGAATGAGGATGGGAGTATTGATACCGATCCGATCCGCATCCTTCTCATTGGACCAGGCGACATCCGTCACGCCATCGCCACGATCGCGCACCGCAAGCG
ATACGCGACACGACCGTTACACATCTACATCTATGAGAAATCCATCGAGACGCTCGCGCGGCACTTTTTGCTGCTGCAGATCGCGCAGGACTGGCAATTG
CCGATACGGCAGCGATGCAACCTGTTTCTCGAAGTGTTTGGCAACTCTCGTGTCCAGGTAAGCTGATCTTTAACTCATGCCTGCCGCTGCTCTATCGCTC
TGCGCATGCTCATAACTGTACTTACCTCGTCTATTTAATATGTAAATGTGAATTGAAGGAGCGAACAAGTGCGTACATTGAAGAGAAAGCCAAGGTCCTG
ATTGACATGCTGCACAATGAGCGTGGATTGCTGGCCGACCAGTTTGATCTCTCGCACTTGAAGATGCGCCATCGCGACGAATTGATTGATACTTTCAGGA
GCTGGTTCCAAAGCGTGCGCTTTGACGGTGGGTCTTTCTTTGGCAGCACGTACAAGAAGCATACCCAGCTGATCACTATCTCACCCTTTTACAGTGGATA
AGCTGCACGATCATCGTCTGCGCCACTACTACGAAGTGCGCTATGACTACCGGAATAACCTCATCGACTGGGATTACACGGTACTTACCAGTTGCTGCAT
TCTTGTGCGAGGTCACTTAGGGTATCAATAACTCGAAATGCGCTGTGTAGATGAGTCTGAAAAAGATCGAGAATGCGAGCGTGATCCACATCAAGCAGTA
TCGCGTGTGGCGTAACAGCGGGATTGCGTTCGAGTTCGGCGACCAAACCTACACGGAGCCCAATCGCACGATGGCAGCATACGCGGAGGTTTGTTAAATT
GACTGGCAGTTTACTTGCTGCTCGTTACTCAGTTTGTCCTTACTGCCATGCGCTGCGTTTGTGCTTCTGTTTTATCACTTAGGCTCGAAAGAAGCACCAC
GGATCAGTTCTCTGCCGAGGTCTGTGGACCGATATCATCATCGGTCCGTTCATCTCGTTTGGCGTTCGATCCGATTCGTCCCATCCGCTCGCGAAACAAC
TTTTTGAAATCCACAACAAAGGCACTGGCGTCGAGCAAAATCGGCATGTAAGTGGTCATTCATAGCATGCTTTTTGTGTGTTTGGCTTGGGTTGGGTGCA
TACGGGGATTAACGATGTGCGGCTGCTTCATCCTCCCTCTATGCGTTAGAACACCGTCGAGGTCGCTGTGTTTAACATCCTCTCGTACTTGTACGAAATG
GAGACTGCGGAGATTTACACGATGAAGAAGGCGCACGACGTGTACAGCGGCATCGGTGAATCAGAACTCGACCAAGGCGGCGTGAGTGAGAACCAGCCGA
GCGACGCCACGTCGTTGTCGACAATCGTGGAGCTCGAAGTGGACAATGAAGAACAAACCGAGGATTCGAGCCAAACTCGCGAAGAAAAACTTGCACAAAG
GTAAAAACAAGTGATGCAACTTTTTTTAAAAATGCCTGGGCTAACAGCATGTTGCTCACGCTATCAACTTTGCCAGCAGCGAGTTGTTCAAGCAGAAAGC
CAAGGAGAGCGCTGCTCGGGAACGAGCGCAAACCATCTACGAGACCTTCGATGGCGTCAAGATCTTCCCGCTCACAGGGGAGCTTGGTGACCTGTACGTG
AAGAAGCGCTACGCTCGAAAATTCGACCACGTGTTTGTTTCCACGCAACACACGCACACATTGCAGGATACAGATGAAGCCAAGTGCTTCTCCAATCTTC
TGGCGGATAACGCAGCAGTCAGCATCGAGTCGTCCGTGTACGTACTTTGACACAAGCAATGGTCTATACTTTGTGTTTGGTTGTGACTTAGTGAAGTGTG
GATTTTGCTGTATGCATTTGTAGTTTTTTGCTGCCGCTAAAGGAAGATCAGCGCGTTCTCTACGTCTCCAAATTGCTGGAAATGGCGCAGGCACATTCGC
TGAAGTCTGCTTTCCAATTTACCAACAAAACTCCAACAAAGGAGGACCTCGAGCAGATCAACGCGTCCGTGCTTCGTTTCAGCTTCA