Description :
From Genome Similarity Track
Location :
Scaffold_82:83260- 84268
Transcript NameFunction/comments
Phyke_g3526hypothetical protein

Sequence
1008 bases(100 bases per row)
ATGCAACACGATGAAGTTATCTGGGGAGTCATCTCCAAGCAGTTTTGCTCCTTCAAGAGCAAGTACGTGGCAGaaactgcaccaccagcaccagtcaCTA
GTGACCTTAGAGACTTCGCATTGACCTCTTTTGTGTTCTATTGTATTGCTATGCAGACTTCCAGGCACTGGCAACATGTTCTGCAGCAATCCCTACAACG
TCACGGGTCTGTGCAATCGCAGTGCGTGTCCATTGGCCAATAGTCGCTACGCCACCATCCGCGAGCATGACGGCGTGTGCTACCTGTACATGAAGACGAT
TGAACGCGCCCACACGCCCAACCGGCTGTGGGAACGTGTGAAGCTCAGCAAAAACTACACCAAATCACTGGCGCAGATCgacgagcagctgcagttctgG
CCCAAGAAACTCAtccacaagaacaagcagcgtCTCACTAAGATCCACCAGTACCTCATGCGTATGCGGAAGCTCACGCTCAAGACCAAGCCCAAACTTG
TGGTGATCAACAAGAAGATTGAACGCCGTGAAAAACGCCGTGAAAAGAAGGCGATGGTTGCTGCAAAGCTCGATAACTCgatcgagaaggagctgcttga
gcgtcTGCAGAAGGGAACGTACGGCGATATTTATAATTTCCCCGAGAGCGAGTTCtccaaggtgctggagagcAATGGTAAGCGTCAAAccatggaggag
gagagcgaggacgaagaggaggtcGAGTACGAAAtggatggcgatgaagacgacgacgacgaagatgcgGGTCAGGTTGAGTACGTCGAGGACTttgaag
aggacgagagcGACCTGGAGGACCTGGCTGATGAATTTGCAGTCGGCGACGAATTATCGGATTCGGAAGCATccagcgatgaggaagatccggccaagtc
caagaaacGCAAGGCGCCGTCTTCGTCGGCTGGCAACTccaagaaaagcaagaagcaacagaaACCCAAGGGGCCGTACGTGGAGATCGAGTACGAGCAG
GAACAAGA