Description :
From Genome Similarity Track
Location :
Scaffold_44:83241- 86088
Sequence
2847 bases(100 bases per row)
TCACCGGGAGAAGTCTCGTACTGGTGATACGACCTAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGACACTTCAATCGTGTATGCGTT
GCTTAAGCGGCGCAGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAATTTACCGGAGAT
AGTAGGACTAGGCCACCTTCATTGAATGAAAGAATATTTACCCTTCCATTCTTGTCTGCCTTTTTGTAGGTCCACTGCTTCTGCAATGGAATCTTGCACG
AAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTAACTCGCTGTCTTTGGCTATAGCGCGCTTGAAGCGCAATGCGGCAAGATCAGTGACCT
GGGTAGTAAAAGCATCCTCGCTCTTACTTCTCTCTTCTTCACCGAAGTAGATGTGATCGACATCGGCGTCATACGTTGTGACCTCGTGGCCAGTACGTGA
TGATGGAGAGCTGAGTTGGCGTTCGCTCGAACGATTCTCTCCCCCCTCAAACTATAGTTACACTTTAAGAAGGTGGGTAGGCGTGGGTGGCGCAAGCCAT
TCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGAA
ATAACCCCGACGGATTTCCTCAGGAACGCGGTTTGCACGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGAGTTCCGAGT
GTTTTGAACACGGATCGCCAGAATTCAGCAGTGAACCGTGGATCTCAATCAGAGACGAGTTCACGAGGCAACCCATGAAGACAATAAAGACACGAGCACA
TGCCGATGCATTGATAGATTCAGGTACAGCGATCAGGTGTACCACTTTACCGAATCTATCAACGAACACAAGAATACCTGTATTCTTGTGTGGGTCTGCG
GGGAATCCAAAGACAGAGTTCATTGAGACTGATTCCCAGAATTCTGCCGAAATAAGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACCAGACTTCACTC
GTTGACATACCTCTCATGCGCGGACGGACTTACGCACGAACTGATACTGGCGAGGTCAGTAAAAGTCGCGACAAACTTTGAGATATGTCTTCTCTCGACC
ACGATGTCCACCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGACGTGTCGCCGGCAACG
GCTGTATACTTCAGTAAGCCATTGTGGACTGTATATCTATCTGTGGAAGATCGATACACTGGGGGCAACCTTTAAGGGATTGACGGGACGAGAGAAGATC
CATCAAACGCACCATCGACGGATCGTACGCCTTGTGTGTGTCTTCGAATAAGGTTGACGACGGGACACTCGACGTCAACACCTCGACAGTGGTCGGACTA
GTGTCGGGTTGCGCAGCTACTTCGAAATCGGGCCGGCGCGACAGAGCATCAGCGACGACATTTAGTCTTCCTGGCTTATATTCCACGGAGACGTTATACT
CCGCGAAGAACGACAGCCACCTCGCCATTCGCTGCGAGAGGTGTGGACTTTTAATGGCCGTGCGTAAGGACGCATGGTCCGTGTAAACGATGAAGGGTCT
GTCAACTAGCAGGTAGACTCTGAATTTCGCCAAAGCGTACTTCATGGCAAGGAGTTCCTTGTCATGTACTGGGTAGTTACGTTCAGCCGGTTGCAGCTGA
CATGACTGATAACAGACGACACTCTCAGCACCGTTTGTGTTGCACTACATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATA
GTCTGTCTTGGTCTGCAATCGCCAAACTGGCGAACGTATCAAGCTTTGCTTGATACCTTTGAATGAGCGCTGAATATCAGCACTCCATGCCCACTTCTTT
TTCTTTTTCAATAAACGAGAGAGATGAACTGTCATCTCGGCGTAATCGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGAACTTTCGAAGTCGGT
AGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCCGGACGCCGTGCTTACCCACGATGCATCCAGGAAGTGGTATTTCGCTTGCAGCA
AATATACACTTCTTGAGATTGGCATACAACTTATGCTCACGCATCAGTGTAAGAACTTTCCGGACTTGGAGTCAGTGGACTTCCAAATCCGTCTGTCCAT
TCATAGCCGCTATGGAAGAACACGTCATCGAAATAGCTGGGTGCGAGTTTTCGCACAGATCTCAACAGATTTGTAACACATCTGTTGAACGTAGCAGGGG
CATTACTCAGCCCTTGTGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCAGTGCTGATCAGGAATGTCCTTTTCACGCATAAGGATCTGA
TAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTCGCCATACCATCTATACTGACATCCTTTCTTGGTATCGGCGTTTGAACCAGTACAG
TCGCAGCATTCAACTTGTTGAAGACATGTAATATCCGCCATCCTTCTGTGGCCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCT
CACATGGCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTTGAACCT
GGTTTCAGGTCGATCTCGTGACGAGTACCCTTATCCTTGGGTATCTC