Description :
From Genome Similarity Track
Location :
Scaffold_34:83217- 84456
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12807hypothetical protein

Sequence
1239 bases(100 bases per row)
ACAGGCATCAATGACGTGTGGGCACATCCCATGTTTCCACCAGTAGAGGCAATTGTACTTCAATTGTCCGGGACTCACTACCCACCCATCGGATGGCATA
CCAAGTGTTTGCATCCTTCGAGAATTCACGGAACCCACCGATTTCAACCGCTCCTTTCTATCCTCAGCGCTGAGGAAGATGCTTGTGATTAACGGTAAAA
CGAATCTCGGTCTTCGTACGCCCCAATGGAAGCTGCGTAGATGAAATACAACGCTGATAAGCTAGTGTCTTGTATAATTTGTACAAGCGCGTAGAAACCT
TCGGGTTGTCACTGAAGACGCGATTTCACATATGAAAGCTAGCTGAGGTCGCTCCATGGACTGCATCATCTCCAACGATGTAGCTCGACGATTCACACAG
TTGATCTTCAGCGTCTTGTGGTATTGCTCGATCGGGTTGTTAGTCACCGCACAACCCGTAGGTGTATGGAACACTTGCTAATTTCCGAACTCAAAGCGGT
TGACTCACATCGCCTTAATATGACGAGCCAAAGCGAACGCTGCTGAGTCGCGTGGCATCGCATCCCATTTGCGAGAATGGCTTGCTTGTTCGTCTCATAG
TCGCGTTCATCGGAGTAGAGTAAATCGTACAAGTCCACGAAAAACTCCCAAGTCTGGTCGGGGTCAACACCCTTGGCCCTAGCTTGCTTGAACACATTCT
GGCAAACGTGGAACCAGCACATCAACACCTTGGACGTGGGAAACTCAGCAAGGCTTGCGTTCCACTGTGCCTTGTCGGTGTCGGACATAACAAACTCTGG
AGCGAAATCCAAGCGGAATTGTTAAAAGCAGACCCTTTTGATGAACTCCAGGCACCACGAAATGTCTTCTTCGCGTCCTCTGGAGATGCAGAAGTATGCG
AGCGGAAAAAATGACCGCCTTTGTCGGAGTAGCTTTTAACCATTGCTGGGTAGCATTGATTCACAATCTTGAACGTGCTGTCGATGTGTAAGATCGTCGT
TTGGTCGACAGCCCGTTGCACATTAACATAATCTTGGAAGAGCTTGTAACACGTGATGCCGACACGAAATGGTGCTACATCACTTCCGCATCCTACAGAG
GCAACCTGCAATATTGGTATCGCACAGAATCACTAAATTTGTTGGCACTTCTGGGTGCATTCCAACCTCATCGTACAAAAGTTGGTCACACATGTCAATG
ACGCGTGCCATCTCGTCGGTGGGGTTTGTTCTTCTCCAA