Description :
From Genome Similarity Track
Location :
Scaffold_10:83212- 84455
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03821Hypothetical protein
Sappa_CBS223.65SPRG_03822Amino Acid/Auxin Permease (AAAP) Family

Sequence
1243 bases(100 bases per row)
GTGTGCGAGCGGCTGGGACACGGACGACATTGACGAAGCGCTGCGTCGACTTCCTCGCGACGTGGTTGCCACCGAAGCCCATCGCTGGGCTTCTTCGTCA
TGAGCACAGCAATCAATACAACGAGTACGAGTAGCAAGTCACAGCTTGTTCATTCATGAGGTCTTGCATGCAGCGGCGCCTTTTCTCGCGACACCGAGAA
GCCCTTCTTGGGCCACCGGAATAAATTTAGGTTATGCGGTGACCCTCCGATGCTGCTGCTGAGGCTCCATAGCTGCGGGCCAGCACCGCGTCGTTTCAGG
TCCATGTCAAGCTGCAACTATTCTTGCATGGGAATCGTCCACCTTCAAAATAGAAAGGCAACAAAATATGGACGGTATTCACCAAAAGTTCAAAAGCTCA
TTACGTACTCTTGGTATTCACTCACATTGTGCAAACGCACTCGACAAAACCACGTGACGAAGCACCTTCGTTTAGTACCCGTAGAGCGCGCGCTTGGAGT
TGAAGAACGTCGTGTTGGTGTAGACCATCTTTTGGTAGTCGCCGGCGCAGAAAGGGAAAATGATCGACGGGTCGCTCTCCGACGGCGCAAAGAGTGCCTT
GCCAGTGTTGATCGAGACGTAAATCGCAAGGAAGGTCGAGACGATGACGGCGAAGTAGGCAAAGATCTTCTCGGGCAGCGAAATCGAGCCGTTGAACGTC
TTGAGGTAAAAGACAATCGGGAGGATCATGCAGCACGTGGCCGTCGACGACGCACCGACAAAGTCGAGCAGGTCGCCAAAGTGATCCTGCCACGCGATCG
CAATGGCCGTGCAGATGGCCACAATGAGGATGCGGAGACCGGCGGCCTTGGCGTAGTTGCCAGGGATGTTGTACGACGTCATCATGTCGGGGCCCTCGAG
CGCTTCAGGCTTCTTGGCTTCTTCCTGGACCGCTTCGACGTCCACATATGCGTTCTCCGTCTCGTGCGCAATCTCAAACGAGTGCTTGTGGAAGCCGAGG
ACGAGGCGCTCGGCGATGAAGAAGGCCGGGAACATGATGACTGCGAACGCAATCGTGATGTGCAGCTGCATGAAGAGGAAAGCGAGGACGACGCCGCCGC
GGGACGCCGCAAAGCCGAGTTTGTCGCTGTTGACCGCAAAGAGAAGGTTGCCAGGGATCTGACAGCCGACGACCCAGACACCCGTGATCGAGACGGCGAG
GAAGCAGAGTGAGATGAGCGTCATGGTCACGAGAATGACGCGC