Description :
From Genome Similarity Track
Location :
Scaffold_137:832- 5997
Sequence
5165 bases(100 bases per row)
GTCTTTCAAGGGCGTCAGAATGCGGCCAGCCATCGTAGTAGAGCACGGGAAGGCAGAGTCCGATACGACGTTCATTCTCATATCCGGGCAGACCATGGGA
TCAAATAACTTGGTGCGGAACCCGAGTGATGTGTCCAAGTCGTTATGCGACCCGGGGCAGTTGTGCTTACACCAAATAATGCAGCCGTCCGCTGCAAAGC
AGAGCGTCCCCGTGACGAAGACGGTATACAACCAACTGTTGTACATTGCATTTAGCAGGTCAGCGTTCGATAGCTGTTGGACCTGGAGTCTATTAGATAT
CAGTAGCCTTGAATCCTTCTCGCAGAAATATAACTCATATAGCAATATGGTTTTTCCTTACTCTCAGATTCTTACCATCTATAAAGCCGAATGTATGCTT
TAAAGGGGGCTCTCGAGCTCCAACGAGTTTGGCAAGCTCAACCGGACGAGGAGAAGATAGCCACGCGATCCTTGCCGGAGCGTATCCCGTCAGGGCCCTG
GACAGCGTTTCCTCTGTACGCGGTAGGATTCTCGACAGTGTGCTTGATGGTACTCCGAACACCAAGCAAAGGGTGTTCTGCTCCATCGAGCCTACGTAAA
AGGACAACACGAGACCCAGAACTTGGTGGAGGTATTTTAGCTTAGGCGGTCGACCGCGAGTCGTGTGATGAGGGATGTTGTAGTAGCGACTGAATCGTCG
AAGGAGCTGGTGGAACGCCGATATGATGTTGTTCGAGTTAGACAAATACGAAGGAGTTTAGCTGTAAAACCGACTTACCTGTTCAAGCTTGTAGCATTTA
AGAAGTTGACGTCATTGCCGTACAGCACCATCCACGCCGAGTGACTCGGCGTGTCAAGGCACTGCGTAGTTATGTAGTGTCTGCTCCGCATGACGGTCTT
CCATGCCTCCTCCACTAGCAGCTGGTACACCTCTCGTCGGACCTAGTTCGGTGCCTTGTCATGACTCAAGAAAGCTTCGGTCAGCACCAGCGCGACGTCC
GACTGGTCGTCCACCATCACTTGAGCAAGACGCGCACAAATTCGGAAGTGAGAAGTATGAACGTGAGCGCGTCTGGTGATGCCCGAACAAAGTGACGGAT
ACATTTGCTAATACAACAAATTATTAAAGCTACTACTGTACCTGATTCAGGGCAATGACATTCGGTCACAGAAATCAGCGGTATACTATTTGTGGTCGAT
CACTTTAGCGAAAAGTCAACATTTATCTTCTTAAACGCTGACATATCTGCTGCAGATAAGTCACCCGTTTAATCGATATTTGGCAGGCCTCCAGTGGTGC
GAAAGAATATACAACTAAGAAACAAGCGGTAATCGTACCTAATGTGGATTGGTCTGAGACATCTAAGTCACTGCAAGATATCATCATACATGATCCGAGA
CTCATTTCGTATGTAGCCAATCAGAAGAAAAGAACTTCAGAGACATTCCCAGATTATAACAAACCGCTGGTGATATGGATGAATATGATAGTTTATCGGA
CCATACTTATAAATTTGTATGGGTATATACTGGCAATTACCTGCCAGCAAATATCACCAACCAATCACAGCTAATCTAAATCATGATTTTAGCCAATCGG
ATGCAGTAGGTATAGGTGAGTCATCCAAGCCACTCGATCGGACGTATCAACTCCGATAAAACTCTAAACTATGTGTATGTTCATTCAGTTGTCAAGAGGT
AGACGTATCACTTTCATATTCCTCTTTATCGGACCTTCGCGATGGGTTTGGAGGAATTGCAACCTGGCAACACATTGCGGGCTATGGCAACTGCTGTCGC
AGCATTTTCCAAGTTTTTAAAGGGTGAGGATGTTGAGGAGGATTACGTTACGAAATGTATTGAGGAGGATGAGAGTGGCAAGAGCTTTGTGTGCGTCATG
GATAAGTTTGGAATGTATCTTGCGTTTAGTGAAGGAAAGAAGTGTAAATTGCTTGCACGAAACACTGCAATGCATAACTATCGCCAAGCAAAAATTTGGC
TCCTAGAGCAATTTCCTCAGCACCAAGCTTCACTAGAATCGCGGCTGCTTAAAATGGGAAAAACTCTAGATAACTCTTGTCTGAAAGAAATGGTGGTGGC
TTTGTAGCAAAGGCTCCACCATGTACAAAGGCTGATTTGAAAAAAATGGTTGTGTATTTGTATGTCAATGCATGTTCTGAGAGTGTCTACCAAGATGCTG
CTCTATGTGGCTGCTCTGGTACCTGTTCGGGCGAGCTTCGGACCTGTCGATGATGAAGAAGCGGAACATCTCTATAGATGCCGCCCGTGTCTTATTCCTT
CGCTTGGTCCGTGCGAAGACGTCGAAAGAACAAGGCTTGTATCTCTTCCCCGACGCCGACTTCACAACTTTCCCCTTGCTCGTTGTTGCTTTCGCCCTCT
CCGTCCAAGCAGCACCGTGTTCAGCTCTCATCGGGAACCTTCCTGACCAAGTGCAGCAAACGCTGACCACACTATCACCTGACGTGCCGCTCGTGAACTC
CTAAACGCATCACCGGCGACCTCTGGTCTTGCTACACCTGGTCCTCCTCCTCCTCGTAGTGCTGCGGCTCCGACAATCTACGCACATGTCAGCCGTATGC
TTGATCGCGTCGCCCCTGCCGCCGGTGTGTCAGCTGCTCTCACGTCGCACGCTTTCCGTCGTGGTGGGGCCCAACCTGCCAACTGCTGCGAGAAGATGAC
CGCGCGCTGGATCTTTGATCGCCGATCTTGGAACCTAAGCACCACAAACAAAGGGGTCAGCTACATCTTCAACACAAGTAGTGAAGACCGCATGATTGCC
AAGGTATTGAGTGGATACAAACCAAAGGACGTTGTCCCTCTCCAAGACCTGTCCAGCTTTGACGCCGACACGCTTGACACGATTGCCGAGTTCCAACGAG
TGTGGTTTGCAGCTTGCTATCAAATAGAGACGGAGAGGTTCAACATCAACCGGAAGGCTCTAGATGTCCTGACCGCTTGCGTCGTTAGGCGCTACCCCGT
CAAAAAGGGCTTGAATCCCAACAGTCCAGCCGTGCATCAAATCGAAACCTGTGTTACGCAGGCGGGACGTACGGTTACGGACCTCTTAGCCTGGTCGACG
CATCTTGCAGAAGCGCAGCATTCCTGTAAAGACAACATAGAAGCATCCACCTCACCATCCATGCCAAAGAAACCAAGCCAAGAATAGAAGATCATCGAGC
ACCAGGCCTCTGTCATTAAACACCTTATGAGAATATTCCAAGCGCCAAGACTCCCGCATGGATATGATTGAGGCTAAGCTGAACGGTGATCCTGTAGCTG
AAACGCGAAAAAGAAGCATTCAAGATGAAGACGCCACAGATGTGAGGAAACCCAAGCTAAAACAGCGTAGAGGATCAGCTAACTACCTTCATGCGACTTA
GTTTACCTGGTACGCGCAAGGGCCACGCTGGTACGTCGAAACACCGAAGTAGCAGCGCTCGAAGGCCAAGCTGCTAGTCGCTTACATGAAGCTTTCTTCG
ACGACGGTTTCGTGCTCAGCCAAACCTCAGCGGACTACCGCGACCGAGTTCTGGAGCTGGGGAAGCGCGTCGAGAATGCCGTACTCAGGTACTTGAAAGT
CAAACACAGCATCAGCTCTCGCGGATCGAGCGCGGTCCTCAAGCTCCTCCAGCGGGTCCACTGCACCGGCGCGCCAAATGCTAAGTTCCAGCGCCACCGC
TAACTGCTCCAGACAGCTGCAATCCAAGACCCGTATCCTGGCTATACGCAGGACGTTCTTGAGGAGGTTAGTAAGTGGAACAAGCATTTAAATGAGAATG
TATTCACCCTTCCTCACAGCATTAAGCTATGCCGACCTCAACACACTTATGCAGTCACCTTTCTTGCTGATCTGAGCTGTCCACGAAACTTGATCTTTGC
TACAAGGCCTCTAGCCCAAGCATAAGCAATAACGATGATCCGATTTGAACAGGCATCCTCAAGGCCGAAATTTTGCGCTCTTCCAGTTAAGCTACATCGT
TGGAAGGGGGGGGGGGTCAGAGGCGACCTGGAGGCTTGGAAGACCGTGCAGCCCGTACGGGAGATCAGCGTGGTTGCGTTGAAAAAAGTAAGACTGGCCG
CCAAAGTGAGCTGTCGGCGACGGATTGACTGAAAGTGAGAGGATGCAAAACATTTAATACGTGTATTCTAACGCAAATAAAAGTGGCACGTTTTTACGGG
CAGATATTTAACCAATAAGCAATAGTAGCTCTGATAACTGGCTGTCGCCAATCTTAATTTACCGGACAGATGCAAAATTATCCGGACGATCGTGGCGATT
CTGCCTTATTGTTGAATATACTAACTCATACGCACGTGACTCTCATGCCAAAAATGCATAGAAAAACAAAATAGTGATTTTCTCAGCCCAGAGGGCGTTT
CAGGCCATTTCCTGCCGTCTATAAAACAGTCTGTTTGACCACTCTTTGGCCTTCAGCGTCATTTCATATCAGGCATGCCCTCCCCTAAACCTCGTACATA
TCTGCGATAAGCTGTGTACAATACATAGGTCTGATAAGGTCACCCGGTCCGATAAATTTTGGTATGGCAATTAATTAATTTCGGAAATTTTTGTCGATGG
CTACGATATAAAGCCAATTCTGATACAAAATCTCAAAAAAGATAGTCATTTCACGAAGAAAAATATAGCGAACGATATATACAACGGCATACGAGCTTAA
ATGTCTAAAACGATTTAATATCCGAGCGATTAAATGGGGAAGCAGCTACCGAGTTAAGGTTAGCGGTAGGACCGGTAAGATGGTGTATGCGAGAAACTTA
TCGCGCCTCAAAAACTTAGAGCTTGTAGCGAAGCTGTACAAGGTCAGTCTCAAGCGACTGGAGAATATCTTATCCCCAGACTATCAAACTGACCCTCACT
ATCGCTTTTTCAGGGGCAACCACATGATTTCGCACCTATACGAAGGAACCCACCGTAGTGAGTTCTATGACAAGCTTCACCACGTTCTTGAGAGTGAGAC
AAGTGCTTACAAAGTTAGCATAACCCTCGGCTATGACCTTGTTAGCAAAGCAGATCATTCTGATTCGAGATACTTCCACTCAAATTTCAGTAATACCTCT
GTGTTCAACCTCACCGCCCCATCAGCAACGCTCGCCTGGATTCTCGCGGCGCGACCAGTACGTCT