Description :
From Genome Similarity Track
Location :
Scaffold_3456:832- 2185
Sequence
1353 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAGCTACTAAGGCAAGGGATCACACCCGCAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGA
AAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGAT
CCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGGTTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGA
AGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAGTGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAG
GTGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAG
GGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGAC
GAAAACGAGTACGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTT
GTGTATCGACATTAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGACGATCCAAGTGAACCGGTGAGAG
CACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTGGCTGGTGTGTTCGACGCAGAGGATAT
CTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTG
TCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGAC
CCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGCC