Description :
From Genome Similarity Track
Location :
Scaffold_867:8316- 12073
Transcript NameFunction/comments
Phyta_totarag11113hypothetical protein

Sequence
3757 bases(100 bases per row)
CATTGCGGGACGATCCCCCAAAGCGATCTGAAGAAAATGAGCCTTGATCCGATGGTACGTCCTCTCGATACATTGATGTCCACCTTTCAGGCTGATGTGG
TAATGATGTAGGGCGTCTTCTTGTAGCGTTTCGGGAATCACCAGCCGAGCAACGAGATCGCGATCTTCATTCGATTGCTTGAACGGCGGACAGTAAAACA
GCAAGCCTGCCTCGTCGTTCACGTAACCTTCATCAATCTTAGCACATGTCGTGGTTACTAATGAGGTAAGCTGCTGTACGTCCCCACGCAAATACTGGTT
GAGATCAACGATCCACTTCTCTTCGTCTTGTGTCATGCAAATTCACTCTTCCCCCGATTCGTTGAACAATCTCCTCCTGTAGGACTTCCGGAGTGCGTCG
CCTACATGATCACGTCACGGCCATGATCTCAGAGTTGTGTGATCGTGGAACTAGCATCTCGTCGAAACGGTTAAGCGTCACCAAGTCTTGGACCTCATAT
TTCGACATCACTTCCGTGCCTCCTTCACGCAGAAGAGTGGCACCAGTGTCCCAATCTCGCTTCATATTAAGGATTCGTGATTTGGCCACGATCTCAGGCG
CTCCATAGCCTGTTGGCGTAGTAATTGCAACCCCCGCGCATTGCACTCGATCTCACCTCGCATCTGTCGGATGACTAAATTCGAATCTCCGCAGATGATA
TGCCGCCCCCTGTCCAGCTCGACCAGAAGATCGAAGCATAGGAGCAAACCGGGTATTCCGCCTCGCTGACCGACATTGTCCTAGCAACATCTCATCCGCC
TCCACGGTAGGTGTCGGCATGGTGATCACCTGTCGGGGACGCTTCATGGGTACTATCGACACCAATATCGCGTCGACCTCTTCACGAGGCGTGATACTCG
CGGCCATTACGCCTAAgatctcgtcctcgccctTGTTCGACTTGACGATATCCGGGGTCCAGCTCACTAGCAACGCGTCCCAGCGACCGAGTCGTCCTTG
CAATCCTGATGAGTGTAATAGCCACGCCAACGGGGAGTGTCGGACCAGTACCTTAACCGATCTCGTCGCTAAATGCGTGTACCAGACATCCAAGATcatg
agcagcgcgagaaccTCGTTGTCGACGATTCCATAGTTGATCTCGTTAGGCTTGAACGTCCAGCTAGTAAACGTAACCGGTTTATATACGCTCTTATGTT
CTTGCATTAACGCAGCCGCGATCGCCCACTTAATCGCATATACCACCATCACCGGTCTTTGGGTATCTGgatcgaagtgctgcaagatTGGCGCTGTCGA
GATTGTGCCCTTCCGTACGATGAATGCCATGACAGCTCGACTCCGCTTTTCATTGTCATCTGTTGATCGAGCTTCACCGCGCTTGACTAGCCCAGATACC
AGGTGCAGTTTCGAACATATCGCCATCTCACAGAAATCGGCCACACGAAGATCATGCAGGACCGACGCCTAGATCGCGAAATCCTAAATGAAGCGTCTGG
AATAGTTGAGACTCTCCAAAAACGGCTGCATCGATCTTAGCGTAGTCGAAAAAGGAAGATTGGCCAGCGACAACAGGTCCTTCGGATGCCGGCCTGTCTG
CAGATACTTGATGGTCCCGGTAGTCGACCTTGCGTAGACCCCAGAAGCTCTTGGCAACACTGGTAGATAGGTTCCACTCGTCACAGGCATctagcagctt
ctccacctttCGCACAATATATCCACAAATCTGCCGCCACAAGAATGTCATCGAGGTAAGGTCGACGACCTAGCACCGACGATTCATTTTCTACACCAGG
CTCTCACTCCTCGAATACGTCGGTCTGGTTGGCGTGATCTTAATTGCTCGTGACCTTGAGAAACCCATACAGCCGGTTGTCAACTAGTCTCTGGTACATC
TGCGGCGCATTCGTCAACCCGAACGGCATTCGATTCCATTCGAACGGAGTAATAAACGCCGAGATCGCGCGCGCTCAATCAGTCATACAGACCACCCAAA
ATCCACTAACCATGTCTAGCGAGCAATACTAGAGGATCTTGTGAAGCTCGTTGGTAAGGGGCATAGGGGACATCATCAGTCGAGTCAGACTGTTGATCAG
GCGGTAGTCAGTACAACGTCTGATGTCAACttcgttcttcttggtgatcACGACGATCGGAGACGTCCATTGTGACGTCGAGTGCCGGACAATCTTAGCT
GACAGCAATCCCTTGATCAGCAGGAACAACTTCTCGTGGAATTGCGGAGCAACTTTGACGACCCGTTGGGTTATTGGTTTGGCATTTCCCACATCAATGT
CGCAGATCGCTAGCAGGTGACAAGGCGTTCCCTTTCCCAATTagaaggtgtcggcggcgCCATATGATCTTCACCAGTCGATCGATCTCTTCCGGTGCAT
TCTCCTCAGGATTTCCTAATTGGATATTCTCGATCTAGATTTCTTCCGTCGTCGATGTGATCTCTAGCAATGCCTCCATGTGTCCTTCGAAGGGTTCTGC
ATACAGCTCACCTCATTCTTTAATGCACACTTGTTCGTCTTCTGCGTGCTCTCTCGCGTGATCACCGGCGAGATCTTGATTACTCTCGTCTGGAACTCGT
CTTAGCATCTGTGGATTTTCTCCAATCCCTGCAGATCGATATTGAATGCGTTTCTGCCTTGCACCCATATCTGCCCCTTGATCTCAGTAATCACTTGAAA
TCTGACCTCGGCAATCAAATCTGCAATCAGTTGGATGTTGACATCTGCAATCTTCGGCATACTTCGCCCTTTCTGCATCCGAGATTGAGTCTTGGTACAC
TCATCGATGCTGACATGTGTCTTCCCAGCCGGTGACGAGTCGGAGTCTCCTCGCATTTCTTCCGTCGTTGGGGCTCCCTTTCGCAGAGTCCTTCGATCGT
GttcgtcgccatcctcgtcgtctccactgCCGAGTTCTGCCAATTTCGCCGATCGCTCCAGCGGCCGGGGCAAGATTGCAGTCGGAGTCTTGTACAGCGG
CCGATCCAAGGCAGGCTCCTGCGGCTCTACGATTTCTGGgtgctcttcgtcgacgtcgactgtCGCTTGGTATACCAGGTTCTGCCACTCGGTGTACCTG
CGTGATCCCACCGAGACGTGCCCAGGTAAGCGTGGCACTCGATCGCCAGCCAGCAACATTCCGATGCGTACGTTGCAATCTAGTACTAACTTGTGATCGC
TCACGTGTGTCAACTGCAGGTAGCGTGTCTTGCCAGGCTGCCAGAGTCGGCACTTATCGATCTCCAACGGTCACTCACAGCTTTCGATTCTGAGGATGAC
TTATGCGCAGCTTTCCTTCCGTTGTCCAACCGACTTCAACATATCGATCTTCGTTCAGGATCGCTTGCTCCACACGATTTCCGTAAAGCGGACGTCTGTC
TGCTAGTTGTACACAGACTTCATCGAGGAGGCAGATCGTGCCGTCGGCAAGATCAAGGCGGATACGGGCAGGGACAATGAAGTCCATGCCAAGAATAAAG
TCCTGGCCGCCGGTGGGCGGGCCTACCCAAACGTCGAAAAATTAAATCAACGATCCAGCGAGCATGATCTTGAGTCTGATACGTCCGGCCGCCGTATACG
GGGATTTTCCAACACCTTCACATCCCAGTGACTGACTTTCATCAATGTAGCACGTAACCTTACGAGCAAAGACGGTATCAATAATAGACACCTCGGCACC
GCTGTCAAGCAGTATGGTTGCTATTTCGTCGTTGATCTTCCCCGCGGCTTTTGGTtg