Description :
From Genome Similarity Track
Location :
Scaffold_6:831576- 832846
Transcript NameFunction/comments
g1094.t1RAW36924.1 hypothetical protein PC110_g6794 [Phytophthora cactorum

Sequence
1270 bases(100 bases per row)
TGCATACGCGATTCGACAGCTCGACGCGTAGGCTTTCTCTTGCGGTTCGAGCGGCGTGCACTTCCAATACTGTCACGCATCACACCACTAGCGACAGGAG
AAACTTCGACTGACGAGGGCGTCGGAGTCGGTTGAGTTGGAAGGTCCGTCAATTCAGGAATGAGGTCTTCTTCATCCAGCGCCACCGTATCAGCGCTACT
TTCTGTAGAAGCCGGGCTAGACATGCCCTCCTCCAGCCGCATATCACCATCACTATCCGGATCTAAATCATCTTCTGCAACATCTGTCAGAAATGTGGCG
CTGGCAATATCTCCTACGAGTACAGAGTCCGTGCCATCCACATGAATACTGCCGTCTGTTTCTGAATCCGAGCTCTCTGCGCGCGAGGAATCTTCACGGC
TATCCGCGTGAGTGCTTGTCAAAGCACGGTCTGCAGCTGTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTATCAGCGCCAGGGCATGGTAT
GCCTGCATGAATGCAGGCAGCCACAATGTGGCAGCACATGCCGTGCATTCGACTGTAGACACACGTACACGCCCTGCTGCGAGTGTCGACTACCCGTCCC
CCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCATGGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCAACGCACCGGCTCTTT
GATTGACGACGTAAAGATCCGCGGATAAGTCGCCGACCGGAGGGATGCGCCGTACGGATAGCCAGCCACGACTGTTCATAAATCGATAAAGCTTGAGCGA
TCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGGCTCGGTTCTGAAAAGCGAGCCGGGCACCGTTGAGATTGCCGACCAACTCTCGGGGTGTAGCC
AGACCTTCCGCACAGTGCAACTTTAGTGTTCGATGATATTGCTTCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGGG
AAAACCGGGTCGAGTTTACCCAAAACCATTTCACATGATCTGTGAGTTTACGTACTCAAGAACCGAGACGAAACCTGTCCCATCGCTCCAAAACGCAGGC
CTTTACAGCAGGAAATGCATCTTGAGTCGCATAATGCATGTCGTACAAATCCGCAAACACAACTCGTGTATCTTCCGTGCTCGCACGGAATGTGCGAGCA
TGTTTCCACACATTCTGTGTCACGTGAAACCAGCACATCAAAATGGTTGTACCTGGAAGCTCGGCCGAAC