Description :
From Genome Similarity Track
Location :
Scaffold_180:8315- 11488
Transcript NameFunction/comments
Phyag_g314930S ribosomal protein S16, putative
Phyag_g3150hypothetical protein PHYSODRAFT_351449

Sequence
3173 bases(100 bases per row)
GACGAACATGGTGGTGAGACTGCGCCTGGCACGCTGGGGCCGCAAGGACCTCCCTTTCTACCGCATCGTGGCGGCGGACGCGCGCGCTCCTCGCGACGGC
AAGCACCTCGAGATCGTACGTGTCTCTTTCTTATTCTTCTATCTGCATTTCCAACTTCATTTCTAACACCATGttttttatttatttatttttttgctAC
TTACATTAGCTTGGTACGTTCAACCCCATCGCCGCCTCTGACGGTGTCAAGGAGCTGCGTGTGAACAGCCAGCGCGTCCGCTACTGGATGTCGGTGGGTG
CGCAGCCTTCGGACCGCGTGGCGCACCTCCTGGGCCTGGCGAACGTGCTGCCCATGCCGCCCACTCGCCAAtacaccaagaagaacatcCCGAAGAAGGA
CCGCGAATAAGAGAAAAGAACGCTAATAGAGGATGGAGCATTTGGACAGTAAAAAAAAGGCGTTTTCTATTAGAAAATGGGGCAGAGGTAGCAATGCAGC
AATGTAGCCTACTTCTTGGGGGTACGGGCCCGTGGAGCAGGGCCTCGGGCCGAACCTCCGCCCTTGAGCATGTGGCCGCCCTTGCGCACTTGTTGGTTGA
ACGTGGCGTTCTGCTCCTCGAGCCAGCGGCggatctccttctgcttctcctccttggctGCGAGTCGAGACTCCTCCTCCCTCTGCTTCTCGCGGTGGAT
GAACTCGGCGTCCCGACGCAATTCGCGTGCTGCGCCCTTGCGTGCACGTTTGACTTGgcgttgcagttgcttgAGCTGAGCAGTGTCCTTGGGCGCCGTC
TTGTCCTTGCGTACGGTGTAGTTCTCGTCGAACATGGGCGCGAACGTTGGGAGCGTGGTTGGTGCGAAACTCTGCAGGCGAAGCGGACGACGAGCGTCCC
AGCATGACTCGAGACGGGTGTGCAGCTTCGAGATGACGGCGTTGACTTCGGATAGACTCGAGTCTTCCAACTGCTTCACGAGAGCGTGGAGAAGCAAGTA
AAGCGGGTAGAACAACTCGTCGAACGATGGTAGTGACGCGTACTGAGCCGATGAAGCGTCGAGGAGAGCCAAGAGAGAACTCAACACTTGAGCACCactg
cacgacgagctgccaGCTAGAGacagacgaggaagagcaggcatcttctcgtcgtcggagtTAGCAGAGACCCACTCCAGTAGATCACGACGCAGCCAGT
GGATTGAAGACTTGttgtcatcgtcttccttgGATTCATCAGCACCCGAAGCCACGAAAGCACGGAGGATGCGAGTGAGGAACGTCATGACCTCAGGCAT
GAATCGTTGCTTGGAGCGCGTCATGTCCAGCGACAGTGACGCGGCAAACAGAGCTTGGGTAGCCTCCTGTGGTGAGTTCACAGTGCCACGAGCCAAACTC
TCTCCGAGCAGAGTTTCCATGGGAGACACGACGTTGTGGCGCAAGTCTGATGTCGGGAAAATGGAGGTCAGCGCcttgaagagaagcagctctGGTAATG
TGGGCCACGCGGAGGTGGATGCACGCTTGTGCAACCGCTTAAAGAGCTGGGCAAGTAGCTCACGCACCACGATACCCGCAGTGTCACCCATCTGCTGAGC
CAGTGTGTACATGCTCTTCGCCAACGAGTCCAGGTCGTGCTTGTGTCCCGCATAGCGCGCCGCAAAGATTAGGAACTGGCGCACCATCActgcgaagaag
cgcttcattttgttcttgttctccaCGCTCAGTCGCGGGTTGTAGTACGTCACAATACGCTCCAAGATGAGGCCACGCTTCTCGGGTGAGTTGCGCGCGT
GCTCCTTGAAGAGCGCTGCCAGCTCCTCAGGAGACTCTGGGCACTCAAACACGAACGgaagctcggcagcagcctcctcAGCATCGTGAATCCGTTTCTG
CTTCTCGGTCTCTTCGTCACtttcagcctcctcctcttcttcttctttctcctcctccttcttctctttcttctccttagcctcctcctcctcatccgaT
TCCGCTTCGGAGTCAGCCTCGGAGTCCTCCTCTTCGCTCTCCTCCCCCTGCTCCTCGTTCTCATCTCCATcctcggcatcttcgtcgacCTCTTCATCCT
CACCACCAGCGGCAAAACGTGCATCAACCGCGTAGCCGTCCGtcaggtcgtcgtccgtaGGCGGCATCATGATAAGCTGcggcgccttctccttcttttt
gCCCTTCTTtcccttcttgcccttccGCTTtccatcatcgtcactgtcactgtcatcatcgtcagcGCCGTGCATACGCGCCACACGCTTCTTTTCCAGC
TCGGCAAGACGGTCACGTTCcttcgccgcagcttcttccggcGACATCCTGCGCTCCGTagccttcgccttcgcctcAAACGCAAATTCACGGGTCAGCT
TATCGAAATCATCCATCGGCTCCTTCGGCAACAACTCCTTGCCATTCGCCCGCGTGGGGCGGAACTCAAGTAGTCCTCTCAGATCCGCGAAGCCTTCATC
CAACTTGTCCGTGGCGTCTTCCTGCGAGTTTTTGTTTTTCTGACGTTCAGCCTTGTACAGCTTGgccttcatcatcacttcCTGCATGACTTCCTTGTGT
GTCTTCCTCTTtccatcctcctcttcagcctcGGGCGCATCAGCGTCTCCCTTGCCACCTCCAAAGTGGAGTTTGTTGACAATGTCCCTGTCCATCTTCC
TGCCTTCCTCGGagtcatcttcttcgtccagcggACCGTCAGCATTGAGACGATCGTAGTCGTCGTCCGTAATCTTTGCACCCTTGTGCGTCAGGAACAA
CGAATCATCCTCATCATCCtgctccgagtccgagtcgtGCAGTGCGAACGTCGACGCGTTgcgcagcttgcgcttgcgctcGGTCTGGAAACGGGCCATC
ATCTTGTCCTCCATGGACAGCGTCGGGTCCTGCTCGCCGAGTCGCTTGTCCTTGAACacgttgctcttgttgcgcGCCTTGTATTCAGCTCCTAAAGTCT
TGCGACGCTTGCGTTCCGCTTCGGctcgcgccgccgccacgttGCGGCCCGCGCCCTTGACGCGCCGCCCGATGACCTCatgcttctgcttggtggcgtt
gctgcgCACGTCGAACGGGTTGGCGccgcgcgagctgctggcgcgcaCGAAGCcgtgcttctgcttcttcgcg