Description :
From Genome Similarity Track
Location :
Scaffold_8:831453- 835051
Sequence
3598 bases(100 bases per row)
GCCTCGTTGAGTGCGCTACAGCAGACCATTGATCAGGTCGAGGCTCTGCGTGAACTTAGCAGATCGTTGACCAGCGGTATGGGGTATACCATGAGACGCA
TCAGGCTGTTCACAACGCGGTAATCAATGCAGAGTCGGATATCGACGCCGTTCTCCTTGATTATCACCACGATCGGCGACGCCCACGGGGAGCTGGGCAC
CCTGTTGATCTTGGCGAACAGCAAACCCTTGATCAGGTCGGACAACTTGCTACGGAACTGCGGTGCCACTCTACGCACGCGTTGGGCTACCGGCTTGGCG
TCCCCTGTATCGATGTCGCAGACGACGCCTCGCGCGGCGGGTGGCAGTGCGTTTCCTTTCCCAAGCAACAGGTGTTGTCGGCTCCAGATGATCTTCCTTA
GGCGATCTACTTCCTCCGGCGTGTTCTCGCCGTCGTTCTCGATCCGGAAATCTTGGAGCTTCACATCTTCCGTGGTCATCGTTATCTCCGGCAGGACCGC
CATATGGCAGTCCACATTTTCCGCAAAGAGCTGGCCTCCTTCGCTGATGCAGACCTGATGGTCCTCCAAAGGTTGACTCGCCGTGGGCGGCTCCAGGGCA
GTCTCGATCGGTTTCGTCTTCGTCGGGCCTTCGGTTTCGTCGCCTTCAGGCATCTCCTCGGCTGTATCCTCGCCTTCCCTCCGGTCAGACACCTTTACGA
TCTGGTTGCTGACTGCCGCGGGATGTTTCAGGATGCTCTTCGACGGATCGTACTGCGGGTGATCGACCATGGGTCCTGCCGGCTCTACNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCGTCGTCTGGAGCCTGATCACGGACGAACGCTGACTTCACCT
TGCCAATCCAAGCCCGCGCGCGATCCTCGTCGTCGTCCTTTCCGGCGAACGCTTTGAGTTCCGACATGGCGGACACGCGAATGCGAGGGATGATTGCCGG
CAGCCCAGTCGAGGTAACGGCTGTGGCTACAGTCGCTTGACGGGAGGCAGGGAGATCCAAGTCGTCCGGATCGTATTCTCCGTGGTCTGATCCCACGGAC
TCCATGTCGACGTCCTGCGGTTCCGTCCTTCTCACCAGGGGCACTGTTGCTCCTTCAAGAAGCGTTCCGTCGTCGAGTTGAAGAACGTCTGCAATCTGTC
TGGGTTTTCGTTCAACCTGCTGGCCGCCACAGGAGCATCTGCCCTGGACATCGCGTTCGATACATGTTGCGATCTGGGTTGTAACATCGCGGCTCCTGAA
GGTCCAAGCTGCATTCGCTCGACTCCCTCCGAGGTGTCTGAGTCGGCCATCGAGGTCGCTGACGCATAATGCGAATGCTGGGACGATCCAGTCGGCGAAG
CCGATCTAGGGAGCTGAATCACCGCGGCTTCCAGCTTCGTCTCGACATTCGTCTGAGTTTCTGCCTCTCCGACCAATACCTTCAGCTTTTCGAAGTGCTC
CGACAGTGTAATCTGGATCGCTTCGAGGTCCAGATGGAACAGATCCTTCGCTGCAAAGGAGCCTGGCGTGATGCCGGCATCCTTCAGCAGGCGCAACA