Description :
From Genome Similarity Track
Location :
Scaffold_144:83117- 84803
Transcript NameFunction/comments
g18454.t1RAW40500.1 hypothetical protein PC110_g3282 [Phytophthora cactorum
g18455.t1ETP48319.1 hypothetical protein F442_05897 [Phytophthora parasitica P10297

Sequence
1686 bases(100 bases per row)
GCGTCTCCGAGTCGTAGCCGGTTGCCAGTGCAGCGTCGTTGGCGCCGAACCAAATGGTAATGAGGGACGGAGTCGTGTACACGCGCTTCCTGATTTCGCG
CTCGATGGTCGGCGCAATGTACTTGAGGAACCATTTCGTGTTGTAGCCCGGGAGTCCTCGCGTGACGACGTCAGCAGTGCGCGAGTATTTGTCCTGCAGC
ATGGCGGCCCACCCGCTTTTCGCGACGTCGGTGCCGTGTTGGGTGAGCGAGTCACCCGTGAGCAGGACCACCGGACGGGGATCCGGTTTCGTATCTGCGA
GCGCAATGACGAGCCAAGCGACGACCGCCGCCGCAGCGAGGAAGCCGAGCAGGAGGCACTTGGCGCGCAGGGTCAGCAGCATGGTGGTGTGGCTGTCGGG
CGCAAAATGTGATTGTGGGGCGACCGTCGTCTCTGCGCGTCGGAAGATCCATGATGATGCACGAAGCAGGGCAAGTGTCCGGTCAAGTCATAATCTGCGA
CGGATTTCCAGCGTATGAAGGAGAGTACGGAGTGAAATGGATAAGCGGATTCTCAATGATCCGTTAGTGTGCTTGGCAGCCCAGCCTTGGCTCATCAGGA
CGTCCGTGGTGCGGGGCAACATGAATTGTACATGTAGCGGTGAAAATGGTGCTTTGGAGGCATCCTGTGGCGTGTCGCGTACAGTGTACTGTTGGGGCGT
AAACGTTGGATGTTTCTGGTGGTCAAATCCCTGAGGCGAGGCCTGAGTTCAGTCAAGCAACGCTAACCAATGCTCGGTTCGTCGGCCCAACAAACCGCGC
ATTTGCTGCCGGCAGCTTGACTGTTTCGTTAGAGCCGCAGTAGCACTGATATATGGGCTTTCAGTGTTTTACTCCCTGAATGTCAAGGCAAGTGGTAAGG
ATGAATACAATAGTAAGGATGAAGCGACACAGTCCATTCGACTGAGCGGGGGGGGGGCAGATTTGCTCTTGCTTCTGCGAAACCTTACGATCATTTTCGT
CACCAGCAGGCCCGCACTGCAGGCAGATCTCAAACTCCTTTTCGATATGACCGTAACCTTCCTAAATGATTTGATACCAGCTCAGTATGATATAATCCAG
AATCTAGTACAAAAAGAGCCAGATTTTGTGTGTTAAAATTATATCTCATACAGAACCGGCACTTTAGTACGGATAAAATCTTACTTTAATCGCAAAAGTC
CGTACATTATCCTAGATATTGTTGGGATATTACGTCCTACGCATATCTAAAAAAACACAACTGAAAAGCAGCTTCACCTCTCGATCGGCACCACAATGTC
ACACCTGGGCTGCAAGCTCTCCCCCCGCTCGTACATGCTGTAGTAATGCGCGACCGTTCGTGCGCTTCCAGCCCGGGTGCTCCTCGCAGATGGCCTTGAT
GTCCTTCTTGCCGGTCTGGAGGCTGGGACTTCTCTAAAGGGAAAAAATGTGAACTCTACGGTTCACATTTTTGTGGGCCGAGCTTGTCCACGAAGTTCTT
GAACTTTTTGGCCGGGTTCTCATCGCCCAACACGTCCGGGTCGACAAGTTGCCGCAGTCCGTCCGACACGAGGTTGAACTGCGGCTTAAATTCCACGGCG
TACGGCTCGATGATACTTTTACTGTCGTCGTGGGCCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCGTCCAGCTC